ID: 1119444343

View in Genome Browser
Species Human (GRCh38)
Location 14:74650815-74650837
Sequence TGAATCAGCACAGTGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119444336_1119444343 21 Left 1119444336 14:74650771-74650793 CCCAATGTGACAGCTGCTGATCC No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data
1119444340_1119444343 -6 Left 1119444340 14:74650798-74650820 CCTGCCACTGTGTCAGGTGAATC No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data
1119444338_1119444343 0 Left 1119444338 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data
1119444341_1119444343 -10 Left 1119444341 14:74650802-74650824 CCACTGTGTCAGGTGAATCAGCA No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data
1119444337_1119444343 20 Left 1119444337 14:74650772-74650794 CCAATGTGACAGCTGCTGATCCT No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119444343 Original CRISPR TGAATCAGCACAGTGTATGG TGG Intergenic