ID: 1119445579

View in Genome Browser
Species Human (GRCh38)
Location 14:74660776-74660798
Sequence TCCCAAACCCCTTGTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119445575_1119445579 15 Left 1119445575 14:74660738-74660760 CCAACAAACTTCTTAGGAGCAGT 0: 1
1: 0
2: 1
3: 15
4: 117
Right 1119445579 14:74660776-74660798 TCCCAAACCCCTTGTGGGTGAGG 0: 1
1: 0
2: 5
3: 37
4: 201
1119445574_1119445579 18 Left 1119445574 14:74660735-74660757 CCGCCAACAAACTTCTTAGGAGC 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1119445579 14:74660776-74660798 TCCCAAACCCCTTGTGGGTGAGG 0: 1
1: 0
2: 5
3: 37
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119445579 Original CRISPR TCCCAAACCCCTTGTGGGTG AGG Intronic
902434062 1:16385856-16385878 TCCCATTCACCTTGTGGTTGTGG + Intronic
902711987 1:18246750-18246772 TCCCAAGCCTGTTGTTGGTGTGG - Intronic
902749803 1:18499761-18499783 GCGCAAACCCCTTATGGGAGGGG - Intergenic
905655436 1:39683721-39683743 TCCCAAACCCCATTTGGCAGAGG - Intronic
908082220 1:60593255-60593277 TCCAAGACCCATTGTGGATGGGG - Intergenic
908393429 1:63703802-63703824 TTCCCAACCCCTTGGGGGTGGGG - Intergenic
911730671 1:101289236-101289258 CACCAAACCCCATGTGGGGGAGG + Intergenic
913701985 1:121382946-121382968 ACTCAAGCCCCTTGAGGGTGGGG - Intronic
914042542 1:144063415-144063437 ACTCAAGCCCCTTGAGGGTGGGG - Intergenic
914135545 1:144897073-144897095 ACTCAAGCCCCTTGAGGGTGGGG + Intronic
915405385 1:155656270-155656292 TCCCATAACGCTTGTGGATGGGG + Intergenic
915468981 1:156114610-156114632 TCCCAGATCCATTGGGGGTGGGG - Intronic
915926184 1:160021420-160021442 ACCCATAACCTTTGTGGGTGGGG + Intergenic
916742159 1:167655542-167655564 TCCCAAACCCCCTCTGGGCAAGG + Intronic
919162867 1:193853792-193853814 TTCTCAACCCCTTGTGGGAGGGG - Intergenic
919673551 1:200359745-200359767 TCCCACACCCTTTGAGGCTGAGG + Intergenic
919885339 1:201929795-201929817 TCCCAAACTTCTTAAGGGTGAGG - Intronic
920489408 1:206401666-206401688 ACTCAAGCCCCTTGAGGGTGGGG - Intronic
922596018 1:226813672-226813694 TCCCTGACCCCTTTTGGGTTGGG + Intergenic
923779610 1:237010432-237010454 TGCTAAACCACTTGAGGGTGAGG + Intergenic
924564312 1:245183778-245183800 TCCCCAACCCCATGCAGGTGAGG - Intronic
1064600233 10:16985696-16985718 CCTCAAACCCCTTATGGGAGGGG - Intronic
1066272584 10:33837852-33837874 ACTCAAAACCCTTGTGGGAGGGG - Intergenic
1066287454 10:33982176-33982198 GCCCAAACCCCTTGTGAGAGGGG + Intergenic
1066305185 10:34133313-34133335 GCCCAAACCCCTTAGGGGAGGGG - Intronic
1069038879 10:63673438-63673460 GCTCAAACCCCTTATGGGAGAGG - Intergenic
1070544107 10:77439413-77439435 TCCCATTCCCTTTGTGGCTGGGG + Intronic
1070725205 10:78782978-78783000 TTCCAATCCCCCTGTGGCTGGGG + Intergenic
1071479518 10:86054481-86054503 TGCCAACCCCCTTCTGGGTGAGG + Intronic
1071810385 10:89173911-89173933 TCTCAAACACCTTGTGGTTTTGG - Intergenic
1071825639 10:89322745-89322767 TCTCAAACCCTTTCTGGATGGGG + Intronic
1071960444 10:90804538-90804560 GCTCAAACCTCTTGTGGGAGGGG - Intronic
1073255660 10:102149385-102149407 TTCCTAACCCTTTGTGAGTGGGG + Intronic
1073440323 10:103548895-103548917 TCCCACCCTCCATGTGGGTGGGG + Intronic
1075896330 10:125998256-125998278 TGCCAAACACCTTCTGGGGGAGG + Intronic
1077490930 11:2860671-2860693 TCCCAGAACCCTTGTGGTAGGGG + Intergenic
1079695211 11:23474163-23474185 TCCTAAAACCCTTGTAGGTAAGG + Intergenic
1080578406 11:33621289-33621311 TCCCAAACCCCTTGGAGCTAAGG - Intronic
1080838961 11:35966792-35966814 TCCCAACCCCTTTGTGGAAGTGG - Intronic
1081312533 11:41591799-41591821 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1081531114 11:43959936-43959958 TCCCAAGCCTCCTGTGGGTTGGG - Intergenic
1081956788 11:47099489-47099511 TCCCAAAGAGGTTGTGGGTGGGG - Intronic
1084302414 11:68260186-68260208 TCCACAACCACTTTTGGGTGGGG + Intergenic
1085663970 11:78395807-78395829 TCCCATATGCTTTGTGGGTGTGG - Intronic
1086181486 11:83956560-83956582 TGCTCAACCCCTTGTGGGAGGGG - Intronic
1087439295 11:98162011-98162033 GCTCAAACCCCTTGTGGGAGGGG - Intergenic
1089786301 11:120909684-120909706 CCCCAAGCCCCTTGTTGGGGAGG - Intronic
1090713489 11:129409433-129409455 TACCAAGCCCCTGGAGGGTGGGG - Intronic
1094146791 12:27236954-27236976 TCCAGAGCCCCTTGTGGGAGAGG + Intergenic
1095748165 12:45682473-45682495 ACTCAAACCCCTTATGGGAGAGG - Intergenic
1099509685 12:83518291-83518313 GCTCAAACCCCTTATGGGAGGGG - Intergenic
1099909157 12:88808521-88808543 TGCCAAATTCCTTGTGGGGGTGG + Intergenic
1101713599 12:107290922-107290944 ACCCAAACCACTGGTTGGTGAGG - Intergenic
1107294437 13:38894632-38894654 GCTCAAACCCCTTGTGGGAGAGG - Intergenic
1107974946 13:45679906-45679928 CCTCAAACCCCTTGCGGGAGGGG + Intergenic
1108297363 13:49037741-49037763 GCTCAAACCCCTTATGGGAGCGG + Intronic
1108511797 13:51163098-51163120 TCCCAAACCCCTTGAGGTTGAGG + Intergenic
1109240447 13:59880306-59880328 TCCCAAATCCCTAGTGTGTTTGG - Intronic
1109378479 13:61526389-61526411 TCTCAAACCCCTTGAGGGAGGGG + Intergenic
1109654040 13:65366456-65366478 GCTCAAACCCTTTGTGGGAGGGG - Intergenic
1109719700 13:66260195-66260217 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1110061130 13:71039632-71039654 GCTCAAACCCCTTGTGGGAGGGG + Intergenic
1111610682 13:90603185-90603207 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1111915632 13:94357255-94357277 TTCCAAACCCTTAGTGGGTTTGG + Intronic
1113288390 13:108878795-108878817 GCTCAAACCCCTTATGGGAGGGG - Intronic
1115127789 14:30017367-30017389 TCCTATTCCCCTTGTTGGTGAGG + Intronic
1115467388 14:33730633-33730655 TCCCTAACTCCGTGTGGCTGAGG + Intronic
1115827046 14:37290197-37290219 TCCCCATCCCCTTGTGTGTGTGG + Intronic
1119023750 14:71136616-71136638 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1119211483 14:72835533-72835555 TCCCCAGCTCCTTGTGGCTGTGG - Intronic
1119445579 14:74660776-74660798 TCCCAAACCCCTTGTGGGTGAGG + Intronic
1120365310 14:83561372-83561394 TACCGAACCCCTTGCGGGAGGGG + Intergenic
1120806184 14:88753231-88753253 GCTCAAACCCCTTGTGGGAGTGG - Intronic
1121623090 14:95363693-95363715 TGCCAAACCACGTGTGTGTGGGG + Intergenic
1124661770 15:31555601-31555623 TCCCACAGCCCATCTGGGTGAGG - Intronic
1126187172 15:45841641-45841663 GCTCAAACCCCTTGTGGGAGTGG - Intergenic
1126920239 15:53513392-53513414 CCCCACACCCCTTGTGGGGCTGG + Intergenic
1131472314 15:92708027-92708049 GCCCAAAGCCCTTGAGAGTGAGG - Intronic
1135479827 16:22813715-22813737 TCCCCACCCCCGCGTGGGTGTGG + Intergenic
1138116005 16:54361223-54361245 TCCCAAACCCCATGTGGAGAGGG - Intergenic
1140564676 16:76027348-76027370 TCACAAACCCCTTGTGGGAGTGG - Intergenic
1140650028 16:77077705-77077727 GTTCAAACCCATTGTGGGTGGGG - Intergenic
1141266588 16:82503201-82503223 TCCCCAGCCCATTGTGAGTGGGG + Intergenic
1143320797 17:6067739-6067761 TCCCAGACTCCTGGGGGGTGGGG + Intronic
1144951093 17:18993867-18993889 TTCCAACAACCTTGTGGGTGGGG - Intronic
1145028873 17:19489552-19489574 CACCAAACCCCTGCTGGGTGAGG + Intergenic
1147212494 17:38880019-38880041 TCCCATTTCCCTTGTGGGGGTGG - Intronic
1147432012 17:40377264-40377286 TCCCAAAGTGCTGGTGGGTGCGG - Intergenic
1148787572 17:50152762-50152784 TTCCAAACCCCAACTGGGTGAGG - Intergenic
1148980966 17:51574581-51574603 TCCCTAGCACTTTGTGGGTGAGG - Intergenic
1149339075 17:55667810-55667832 TCCTAATCCCCTTGTTGGTGAGG + Intergenic
1150931472 17:69589956-69589978 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1152512276 17:80798483-80798505 TCCCAAACCCCCTGAGGGACTGG - Intronic
1152539770 17:80969101-80969123 TGCCAGACCCCGTGTGGTTGTGG + Intergenic
1152874008 17:82775415-82775437 TCTCAGACCCCTTTTTGGTGAGG + Intronic
1155647669 18:28099616-28099638 TCCCTAACTCCTTTTGGGTTTGG - Intronic
1157533052 18:48438611-48438633 TCCTAAAACCCTTGTAGATGGGG + Intergenic
1157566744 18:48683620-48683642 TCCTGAACCCTTTGGGGGTGGGG - Intronic
1158435221 18:57430611-57430633 TGCCAAAGCCCTTTGGGGTGGGG + Intergenic
1159536359 18:69719858-69719880 TCCCAGGCCCCATGTGGTTGAGG + Intronic
1161849552 19:6731439-6731461 CCCCAAACCCGCTGTGAGTGAGG + Intronic
1162142196 19:8591769-8591791 CCCCAAACCCCTTGAGGGGTGGG - Intronic
1163156981 19:15445025-15445047 TCCAAGACACCTTGGGGGTGGGG + Intronic
1163554261 19:17983492-17983514 TCTCACACCCCTGATGGGTGGGG + Intronic
1163760239 19:19132583-19132605 TCCCCACCCCCATGAGGGTGTGG + Intronic
1164204058 19:23043356-23043378 TCACAAAGGCCCTGTGGGTGGGG + Intergenic
1165729912 19:38138582-38138604 TCGAAAACCCCCTGTGGGAGGGG - Intronic
1166303345 19:41924047-41924069 CCCCAAACAGCTTGTGGGGGAGG + Intronic
927095789 2:19746869-19746891 TCTCAATCCACTTGTGGGTCTGG - Intergenic
928305523 2:30167265-30167287 TCTAACACACCTTGTGGGTGAGG - Intergenic
928727281 2:34189320-34189342 TCTCAAAGCCCTTGTTGGCGTGG - Intergenic
929725942 2:44427893-44427915 GCCCAAACCCCTTGTGGGAAAGG + Intronic
930533267 2:52615812-52615834 TCTCAAACCCCTTGTTGGAGGGG - Intergenic
930713322 2:54569887-54569909 CCCCAAACCTGTTCTGGGTGTGG + Intronic
932337752 2:70940529-70940551 ATCCAAACACCATGTGGGTGTGG + Exonic
935894516 2:107720101-107720123 GCCCAAACCCCTTATGGGAGGGG - Intergenic
936647601 2:114389365-114389387 ACTCAAACCCCTTGTGGGAGGGG - Intergenic
937074873 2:119095921-119095943 TCCCCAACCCCTTGTGCTTCCGG - Intergenic
937869074 2:126774857-126774879 TTCCAAGCCCCTTGTGGTTGGGG + Intergenic
939256207 2:139747405-139747427 GCTCAAACCCCTTATGGGAGGGG - Intergenic
939356859 2:141114128-141114150 GCTCAAACCCCTTATGGGAGAGG + Intronic
939776090 2:146390306-146390328 TCTCAAACCCCTTGCAGGAGGGG + Intergenic
940658634 2:156519751-156519773 GCTCAAACCCCTTGTGGGTGGGG + Intronic
940659956 2:156533810-156533832 GCTCAAACCCCTTATGGGAGGGG + Intronic
941298136 2:163766364-163766386 AGCCAAACCCCTTTTGGGTCTGG - Intergenic
941446247 2:165603418-165603440 TTGCAAACGTCTTGTGGGTGAGG - Intronic
942316746 2:174703492-174703514 TACCTAATCCCTTGTGGTTGGGG + Intergenic
943736277 2:191358763-191358785 TGCCAAGGCCCTTGTGAGTGAGG - Intronic
943749137 2:191493769-191493791 ACTCAAACCCCTTATGGGAGGGG + Intergenic
943972718 2:194431618-194431640 TCCCAAACCCCCTGTGAATGTGG - Intergenic
944945372 2:204678154-204678176 GCTCAAACCGCTTGTGGGAGGGG + Intronic
945065680 2:205945995-205946017 TGCCAGTCCCCTTGAGGGTGTGG + Intergenic
945267544 2:207905767-207905789 TATCAAACACCCTGTGGGTGGGG - Intronic
945884788 2:215363683-215363705 TCCCCAAATCCTGGTGGGTGAGG - Intronic
946185766 2:217979639-217979661 TCCCAGAGCCCTGGGGGGTGGGG - Intronic
946391080 2:219417535-219417557 ACACAAACCCCTGGTGTGTGTGG + Intergenic
946954060 2:224909242-224909264 CCTCAAACCCCTTGTGGGAGTGG + Intronic
947713159 2:232327138-232327160 TCCTAAACCCATAGAGGGTGGGG + Intronic
947720231 2:232365607-232365629 TCCTAAACCCATAGAGGGTGGGG + Intergenic
1168868958 20:1112985-1113007 TCCCATTCCCCTTGTCCGTGGGG - Intergenic
1168876090 20:1173294-1173316 TCCCAAAGCCCTTGTAGGTAGGG - Intronic
1176981592 21:15387141-15387163 ACTCAAACCCTTTGTGGGAGGGG - Intergenic
1178164824 21:29961832-29961854 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1178913322 21:36693470-36693492 TCCCAAAGCCCAGGTGTGTGTGG + Intergenic
1179557110 21:42186766-42186788 TACCAAAGGCCATGTGGGTGAGG - Intergenic
1179969975 21:44830596-44830618 ACCCCCACCCCTTTTGGGTGTGG - Intergenic
1180139897 21:45886855-45886877 TCCCGAACCCCATGCGGGGGTGG - Intronic
1182900382 22:33893734-33893756 TTGCAAACACCTTGTGAGTGGGG - Intronic
949201473 3:1385512-1385534 TCCCATATTCCTTGTGGTTGTGG + Intronic
949874727 3:8618694-8618716 TAGCAATCCCCTTCTGGGTGTGG + Intergenic
950589870 3:13929508-13929530 TCACCAACCCCTCCTGGGTGTGG - Intergenic
950789624 3:15461879-15461901 TCCCAAACCCATTCTCGGGGGGG - Intronic
951501372 3:23390729-23390751 GCTCAAACCCCTTGTGGGAGAGG - Intronic
954510565 3:51121250-51121272 TCCCCAACCCCTTGTGCTTTCGG + Intronic
955038768 3:55294034-55294056 GCTCAAACCCCTTATGGGAGGGG - Intergenic
955609233 3:60739444-60739466 ACTCAAACCCCTTGTGGGAGAGG - Intronic
955712986 3:61799814-61799836 TCACTAACCCCTTGAGAGTGTGG + Intronic
955814281 3:62825569-62825591 TCTCCAATCCCTTGTTGGTGAGG + Intronic
957567042 3:81897344-81897366 TCCCAAACCACTAATGGCTGTGG - Intergenic
959164324 3:102758378-102758400 GCTCAAACCCCTTATGGGTGGGG + Intergenic
959723243 3:109515697-109515719 TCTCAAACCCCTTGCAGGAGAGG + Intergenic
962687745 3:137863550-137863572 GCTCAAACCCCTTGTGGGAGGGG - Intergenic
964586300 3:158307509-158307531 TTCCAAACCACTTTTGGGTGTGG + Intronic
965085380 3:164089062-164089084 ACCCAAACCCCTTATGGGAGGGG - Intergenic
965299664 3:166994485-166994507 TTTCAAACCCCTTGTGGGAATGG + Intergenic
968660238 4:1795784-1795806 CCCCAGACCCCTGCTGGGTGGGG - Intronic
969108945 4:4829294-4829316 TCCCAAAGTGCTTGTAGGTGAGG - Intergenic
969109038 4:4829764-4829786 TCCCATTCCCCTTGAGGATGAGG - Intergenic
969639500 4:8388553-8388575 CCACAGACCCCGTGTGGGTGAGG + Intronic
970943370 4:21661487-21661509 GCTCAAACCCCTTATGGGAGTGG - Intronic
975246934 4:72130639-72130661 TCTCAAGCCCCTTGTGGGAGGGG + Intronic
978579752 4:110220134-110220156 ACTCAAACCCCTTATGGGAGCGG + Intergenic
979913892 4:126405427-126405449 TGCTGAACCCCATGTGGGTGGGG - Intergenic
982869082 4:160553398-160553420 GCTCAAACCCCTTGAGAGTGGGG + Intergenic
983938271 4:173518020-173518042 TCCCACAGCCCTTCGGGGTGAGG - Intergenic
984097994 4:175455158-175455180 TCTCAAACCCCTTGTGGGAGTGG + Intergenic
984373668 4:178899666-178899688 TCCCAAAGCCCACGTGGATGTGG + Intergenic
984718766 4:182951360-182951382 ACTCAAACCCCTTATGGGAGGGG + Intergenic
985138244 4:186811705-186811727 GCTCAAACCCCTTGTGGGAGAGG + Intergenic
985293238 4:188407326-188407348 ACTCAAACCCCTTATGGGAGGGG - Intergenic
985651538 5:1109944-1109966 TCCCAAAGGCCTTCTGTGTGGGG - Intronic
987268333 5:16278978-16279000 GCTCAAACCCCTTATGGGAGGGG - Intergenic
989505011 5:42217177-42217199 GCTCAAACCCCTTTTGGGAGGGG + Intergenic
990376598 5:55176646-55176668 TCCCCAACCCCTGCTGGGCGGGG - Intergenic
991214300 5:64144534-64144556 CCCCAAAGCCCTTTTGGGTGTGG - Intergenic
992160039 5:73992355-73992377 GCTCAAACCCCTTATGGGAGGGG + Intergenic
992168099 5:74074605-74074627 TCTCAAACCCCTTGTGGGAAGGG - Intergenic
994762770 5:103877918-103877940 GCTCAAACCCCTTATGGGAGGGG + Intergenic
995494415 5:112726032-112726054 GCTCAAACCCCTTATGGGAGGGG + Intronic
997318027 5:132954388-132954410 GCTCAAACCCCTTGTGGGAGGGG + Intronic
998096133 5:139396446-139396468 TCCCAAATTCCTTGTGGTTCTGG + Intergenic
998112448 5:139512668-139512690 TCCCAGTCCCCATGTGGGTGAGG + Intergenic
999811418 5:155131146-155131168 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1004175853 6:13339492-13339514 TCACAAGCTCCTTGAGGGTGGGG - Intergenic
1007163293 6:39810461-39810483 TCCCAGACCCCTGGTTGCTGTGG + Intronic
1007231229 6:40348922-40348944 CCCCAAAGCCCCTGTGGGTTTGG + Intergenic
1010634448 6:78240186-78240208 ACCCAAACCCCTTATGGGAGGGG - Intergenic
1014179833 6:118372640-118372662 TATCAAGCCCCTTGTGGGTCTGG - Intergenic
1014369328 6:120584632-120584654 TACCAAACTCCTTGTGGGAGGGG - Intergenic
1015711924 6:136151453-136151475 TCCCAAACAACTTGGGGGTTAGG + Intronic
1018174133 6:161164377-161164399 TCCCCAACCCCATGAAGGTGCGG + Intronic
1019365928 7:632806-632828 TCCCAGACCTGTTGCGGGTGTGG - Intronic
1020682008 7:11248504-11248526 TCCCAAAGCCCTTATAGTTGAGG - Intergenic
1025749822 7:64283971-64283993 TCCTAAATCTCTTGTGGGTGCGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1030703755 7:112669403-112669425 TCCCAAACCCATAATGGGAGAGG + Intergenic
1031766193 7:125780990-125781012 TTTCAAACCCCTTGTGGGATGGG + Intergenic
1031885128 7:127238543-127238565 GCCCACACCCCTTGTGGGTGAGG + Intronic
1034738722 7:153453790-153453812 TGACAAATCCCATGTGGGTGTGG + Intergenic
1034936359 7:155203194-155203216 CACCAACTCCCTTGTGGGTGTGG - Intergenic
1040278069 8:46024018-46024040 TCCCAAGACCCTTCAGGGTGCGG + Intergenic
1041021387 8:53642459-53642481 TCCCGAACTCCTTGGGGGAGGGG - Intergenic
1044860036 8:96514378-96514400 TCCCAAACCCCTGGCAGGTTGGG - Intronic
1048540980 8:135341958-135341980 TCCCAATCCCCTTGGGTGGGAGG - Intergenic
1049836439 8:144738509-144738531 TCCCAAACTCCAGGAGGGTGTGG + Intronic
1050118942 9:2288463-2288485 TCTCAAACCCCTTGCGGGAAAGG - Intergenic
1050934621 9:11379872-11379894 GCTCAAACCCCTTGTAGGAGGGG + Intergenic
1051263539 9:15288849-15288871 GCTCAAACCCCTTATGGGTGGGG - Intronic
1052050980 9:23849811-23849833 CCCCCAACCCTTTGTGTGTGAGG + Intergenic
1052459798 9:28747629-28747651 GCTCAAACCCCTTATGGGAGAGG - Intergenic
1055505076 9:76939783-76939805 TACCCCACCCCATGTGGGTGGGG + Intergenic
1056085670 9:83147501-83147523 ACTCAAACCCCTTATGGGAGGGG + Intergenic
1056253699 9:84776712-84776734 TCCAAAACCCCATGAGTGTGAGG + Intronic
1056301726 9:85249294-85249316 GCTCAAGCCCCTTGTGGGAGGGG + Intergenic
1057187561 9:93065465-93065487 TCCCAAACCTCTGGCTGGTGGGG + Intronic
1058321493 9:103636704-103636726 TCTCAAACCCCTTGAGGGGGAGG - Intergenic
1061130640 9:128706003-128706025 CCCCAAACCCCAGCTGGGTGAGG + Intronic
1061529718 9:131200978-131201000 TACCAAACCCCACGTGGATGGGG - Intronic
1062451912 9:136619335-136619357 GCCGAGACCCCTTCTGGGTGAGG + Intergenic
1062497754 9:136839632-136839654 TCCCACAACCCCTGGGGGTGTGG + Intronic
1185945278 X:4368254-4368276 TCTCAAACCCCTTGCAGGAGTGG - Intergenic
1185961740 X:4552299-4552321 GCTCAAACCCCTTGTGGAAGGGG + Intergenic
1188183703 X:27088343-27088365 GCTCAAACCCCTTGTGGGAGAGG + Intergenic
1188378907 X:29467493-29467515 ACTCAAACCCCTTGAGGGAGGGG + Intronic
1188750645 X:33901764-33901786 TCTCAAACCCCTTCTGGGCTTGG + Intergenic
1190055149 X:47177068-47177090 TCCCAACCACCTTTTGGGAGAGG - Intronic
1190483027 X:50896879-50896901 GCTCAAACCCCTTATGGGAGGGG + Intergenic
1193144634 X:78064285-78064307 CCTCAAACCCCTTGAGGGAGGGG - Intergenic
1196861611 X:120033929-120033951 GCTCAAACCCCTTATGGGAGGGG - Intergenic
1197255448 X:124258096-124258118 AACAAAACCCCATGTGGGTGTGG + Intronic
1197926344 X:131650590-131650612 TCCAAACTCCCTTGTGGGTTGGG + Intergenic
1198691161 X:139286341-139286363 TACCAAACACCTTGTGGATAGGG + Intergenic
1199970691 X:152858532-152858554 CCCCAAACCCCTTTTGACTGGGG + Intronic
1201731688 Y:17211179-17211201 TCTCAAACCCCTTGCAGGAGGGG - Intergenic