ID: 1119445620

View in Genome Browser
Species Human (GRCh38)
Location 14:74661087-74661109
Sequence TGAAAGGGCAAGAGTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 1, 2: 14, 3: 52, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119445608_1119445620 13 Left 1119445608 14:74661051-74661073 CCCTGCCTGGCACCATGGACAGC 0: 1
1: 0
2: 2
3: 37
4: 345
Right 1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG 0: 1
1: 1
2: 14
3: 52
4: 390
1119445610_1119445620 8 Left 1119445610 14:74661056-74661078 CCTGGCACCATGGACAGCAATCA 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG 0: 1
1: 1
2: 14
3: 52
4: 390
1119445613_1119445620 1 Left 1119445613 14:74661063-74661085 CCATGGACAGCAATCAGGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 177
Right 1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG 0: 1
1: 1
2: 14
3: 52
4: 390
1119445609_1119445620 12 Left 1119445609 14:74661052-74661074 CCTGCCTGGCACCATGGACAGCA 0: 1
1: 1
2: 3
3: 35
4: 304
Right 1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG 0: 1
1: 1
2: 14
3: 52
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119445620 Original CRISPR TGAAAGGGCAAGAGTGGGAC AGG Intronic
900182626 1:1319004-1319026 TGAAATGGCCAGAGTGGGACAGG - Intronic
903356137 1:22748991-22749013 TAAAAAGGAAAGAATGGGACAGG - Intronic
903488293 1:23707844-23707866 TGAGAGGGCAAGAGGAGGAGGGG + Intergenic
903539741 1:24090207-24090229 TGCAAGGCCAGGACTGGGACGGG - Intronic
903704982 1:25279031-25279053 AGGAGGGGCAAGAGTGGGAGGGG + Intronic
903722245 1:25414290-25414312 GGGAGGGGCAAGAGTGGGAGGGG - Intronic
904326817 1:29731916-29731938 TGGCAGGGCAGGAGTGGAACCGG - Intergenic
904330335 1:29754410-29754432 GGAGAGGGCAGGAGGGGGACAGG - Intergenic
904586347 1:31583106-31583128 GGAAAGGGTAAGTGGGGGACTGG - Intronic
905020788 1:34809870-34809892 TAGAAGGGCAAAAGTGGGAGGGG + Intronic
905022099 1:34825233-34825255 GGAAGGGGCCAGAGTGGGACTGG - Intronic
905806439 1:40880903-40880925 TGGAGGGGCAAGAAGGGGACTGG + Intergenic
905905940 1:41618575-41618597 CGAAAGGGAAAGAACGGGACAGG - Intronic
906279829 1:44545592-44545614 TGCAAGGGCAACAGTGGGGGTGG + Intronic
906728394 1:48060583-48060605 TGAAATGGGAAGAGGAGGACAGG - Intergenic
908808123 1:67951766-67951788 TGAAAGAGCATGAGTGGGGCTGG + Intergenic
908892309 1:68861462-68861484 TGCAAGGGCAAGAGTGAGACTGG + Intergenic
910047460 1:82934350-82934372 TGAAAGGGCAGCAGAGGGTCTGG + Intergenic
910629250 1:89339409-89339431 TGTAGGGGCAGGAGTGAGACTGG - Intergenic
911095061 1:94048166-94048188 TGACAGGGCAGGAGAGGGTCTGG - Intronic
911612804 1:99975640-99975662 TGAAAGAACAAGACTGAGACAGG + Intronic
911693550 1:100862442-100862464 TAGAAGGGCAAGAGTGGGACAGG - Intergenic
911934173 1:103945884-103945906 TGAAAGCTCAAGAGTGGGGGTGG + Intergenic
911993197 1:104729148-104729170 GGAAAGGGCAAGAGTGTGGGGGG - Intergenic
913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG + Intergenic
914977510 1:152379800-152379822 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
915024211 1:152812359-152812381 TGAAAGGGCAAGAATAGGCCGGG + Exonic
915950777 1:160188638-160188660 GGAAAGGGGAAGGGTGGGACTGG + Intergenic
915974222 1:160374589-160374611 CCAAAGGGCCAGAGTTGGACGGG + Intergenic
917094432 1:171385927-171385949 TAAAAGGGGAACAGTGGGCCGGG - Intergenic
917138556 1:171811525-171811547 TGGAAGAGAAAGAGTGGGAAGGG + Intronic
917176513 1:172241876-172241898 TGTAAGAGCAAGATTGGGAAGGG + Intronic
917472861 1:175340889-175340911 GGAAAGGGAAAGAGGGGGAGAGG - Intronic
918229428 1:182514664-182514686 TTGGAGGGCAAGAGTGAGACTGG + Intronic
918280955 1:183005419-183005441 AGAAAGGGAATGAGTGGGAGTGG - Intergenic
918433134 1:184483093-184483115 TGAAAGGGCCACAGTGTGTCAGG - Intronic
918796344 1:188901685-188901707 TAAAAGGGCAAAAATCGGACCGG - Intergenic
919540468 1:198839233-198839255 CGAAAAGGCAGGAGTGTGACAGG + Intergenic
920054768 1:203183904-203183926 TGGGAGGGCATGATTGGGACAGG + Intronic
920309868 1:205042869-205042891 TGAAGGGGCAGGAGAGGGGCGGG - Intergenic
923499948 1:234556273-234556295 TCACAGGTCCAGAGTGGGACTGG - Intergenic
924190523 1:241546925-241546947 TGAAAGAGGAAAAGTGGGACTGG + Intronic
924339184 1:243012698-243012720 TAAAAAGGCAAAAGTGGGCCAGG - Intergenic
1062959474 10:1561869-1561891 TGCATGGGCAAGAGTGGGAGAGG - Intronic
1063548773 10:7008055-7008077 GGAAAGGGCTATTGTGGGACAGG - Intergenic
1063884154 10:10561010-10561032 TTAGGGGGCAAGAGTGGGAGGGG + Intergenic
1068310174 10:55265135-55265157 TGGAGGGGCAAGAGTGAGACTGG - Intronic
1068532505 10:58205669-58205691 TGGAAGGAGAAGAGTGGGAAGGG + Intronic
1069787879 10:71000953-71000975 TCAAAATGCAACAGTGGGACAGG + Intergenic
1070462853 10:76687280-76687302 GGAAGGGGTAAGAGAGGGACAGG - Intergenic
1070855913 10:79607968-79607990 TGAAGGGGCAAGAGTGAGGTTGG + Intergenic
1072810569 10:98458170-98458192 TGAAAGGACAGGAATGGGGCGGG - Intronic
1072830468 10:98652398-98652420 TGAAAGGGTATATGTGGGACTGG - Intronic
1072896585 10:99372407-99372429 TGCAAGAGCAAGAGTGGGCAAGG + Intronic
1072923539 10:99596560-99596582 TGAAAGGGATAGAGTGGTAGGGG + Intergenic
1073142145 10:101255198-101255220 TGAGAGGACAAGAGAGTGACTGG + Intergenic
1073597815 10:104817663-104817685 AGAAAGGGGAAGAGGGGGAGGGG - Intronic
1073788759 10:106918619-106918641 AGAAAGGGAGAGAGTGGGGCAGG + Intronic
1074885075 10:117686856-117686878 TGAAGGAGGAACAGTGGGACAGG + Intergenic
1075361647 10:121841765-121841787 CGGAAGGGCAAGAGTGGGTAAGG + Intronic
1075408312 10:122209406-122209428 GCAAGGGTCAAGAGTGGGACAGG - Intronic
1075621636 10:123932582-123932604 TGCAAGGAGCAGAGTGGGACAGG - Intronic
1075666683 10:124235874-124235896 AGAAAGGGCAGGAGGGGGCCAGG - Intergenic
1076561701 10:131370842-131370864 TGAAAGGGCAAAAGTAGGGGAGG - Intergenic
1076798429 10:132809830-132809852 TGTGAGGCCAAGAGAGGGACGGG + Intronic
1077032333 11:474182-474204 TGAAAGGGCCAGAGAAGGCCTGG - Intronic
1077178218 11:1200115-1200137 TGAGATGGCAAGGGTGGGGCTGG + Intronic
1077712757 11:4552742-4552764 TGAAAGGGCAAGAGTGAGACTGG - Intergenic
1078013747 11:7594484-7594506 TGAAAGAGAGAGAGTGGGCCAGG + Intronic
1078761926 11:14258701-14258723 TGAAAGTGCAACACTGGGAGAGG - Intronic
1079282265 11:19098052-19098074 TGGAAGAGCAAGAGTATGACTGG - Intergenic
1080407129 11:31989074-31989096 TGGAGGGGCAAGAGTGGAAGAGG + Intronic
1081101797 11:39011086-39011108 AGAAAAGACAAGAGTGTGACTGG - Intergenic
1081516673 11:43838363-43838385 TAGATGGTCAAGAGTGGGACAGG - Exonic
1082084629 11:48039771-48039793 AGAAAGGGCAAAAGGGAGACTGG - Intronic
1083563259 11:63691550-63691572 TTAAAAGGAAAGATTGGGACAGG - Intronic
1084289612 11:68153433-68153455 TGAATGGCCAAGACTGGGAAAGG - Intergenic
1085085143 11:73661686-73661708 GGATAGGGCCAAAGTGGGACAGG - Exonic
1085430607 11:76445022-76445044 TGAAGGGGCAAGATGGCGACAGG - Intronic
1085484483 11:76850410-76850432 TGAAAGGGCAAGAGAAAAACAGG - Intergenic
1086002860 11:82001885-82001907 TGGAGGGGCAAGAGTGAGGCTGG + Intergenic
1086306126 11:85482835-85482857 TGTAAGGTCTAGACTGGGACTGG - Intronic
1086877803 11:92118394-92118416 AGAATGGGGAAGAGTGGGAGGGG + Intergenic
1086948502 11:92867479-92867501 TGAAAGGCCAGGGGTTGGACAGG - Intronic
1087455771 11:98384087-98384109 TGGAGGGGCAAGAGTGACACTGG - Intergenic
1087461661 11:98455043-98455065 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
1088759534 11:112916087-112916109 TGAAAAGGCAAGAGATGGAGAGG + Intergenic
1088926389 11:114307494-114307516 TGGAGGGGCAAGAGTGGAAGTGG - Intronic
1089122375 11:116146362-116146384 TGGAGGGGCAAGAGTGAGGCTGG - Intergenic
1089143232 11:116304955-116304977 TGAAAAGACAAGTGTGTGACAGG - Intergenic
1090504973 11:127301255-127301277 TCAAAGGGAAAGAGTAGGAAGGG + Intergenic
1090729320 11:129555999-129556021 TGAAAGGTCAAGAGAGCGAGAGG - Intergenic
1090753825 11:129771150-129771172 TCAAAGGACAAGAGTGGGAGTGG - Intergenic
1090781400 11:130010196-130010218 AGAAAGGGGAAGAGGGGGAGGGG + Intergenic
1091689844 12:2588416-2588438 AGACAGGGCAAGAGAGAGACAGG - Intronic
1091730165 12:2874734-2874756 TCAAAGGGCAAAAATGGGACTGG + Intronic
1092047023 12:5438841-5438863 TGACAGGGCTGGAATGGGACTGG - Intronic
1092446904 12:8566592-8566614 TGTAGGGGCAGGAGTGAGACTGG + Intergenic
1092569785 12:9709377-9709399 TGGAGGGGCAGGAGTGAGACTGG - Intergenic
1093369900 12:18354292-18354314 TGGAGGGGCAAGAGTGATACTGG + Intronic
1093528464 12:20133218-20133240 TTAAACAGCAAGAGTGGGAGAGG + Intergenic
1095561749 12:43574156-43574178 GGAAAGGGAAGGAGTGGGAATGG + Intergenic
1095752237 12:45726908-45726930 TGATGGGGCAAGAGTGGGAACGG - Intergenic
1096556789 12:52408815-52408837 TCAAATGGAAAGAGTGGGAGAGG + Intergenic
1096913354 12:55006317-55006339 TGCAAGGGCAAGGGTGGTGCTGG - Intergenic
1097077902 12:56408761-56408783 TGCAGGGGCAGGAGTGAGACTGG + Intergenic
1097200980 12:57278374-57278396 CGAGACGGCAAGAGTGGGAGAGG - Intronic
1097844690 12:64354277-64354299 TGAAAAGCTAAGAGTGAGACAGG + Intronic
1099462224 12:82937636-82937658 GGAGAGTGAAAGAGTGGGACAGG + Intronic
1101131450 12:101695358-101695380 TGAGTGGAGAAGAGTGGGACTGG + Intergenic
1101216946 12:102594837-102594859 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
1101455524 12:104826625-104826647 TGGAAAGGCAAGAGTGAGACTGG - Intronic
1102095178 12:110233898-110233920 TGAAAGGGAAAGAGTATGTCTGG + Intergenic
1102352715 12:112206198-112206220 TGAAAGGGCAGGTGTTGGTCAGG + Intronic
1102787960 12:115619558-115619580 TGCAATGGCAAGGATGGGACAGG - Intergenic
1103344309 12:120239103-120239125 AGGAAGGGCAGTAGTGGGACAGG - Intronic
1103798298 12:123520266-123520288 TGAAAAGGCAAGGCTGGGAGTGG + Intronic
1104581966 12:130017329-130017351 CAAAAGGGCAAGGGTGGGAGAGG - Intergenic
1104621918 12:130320403-130320425 TGGGAGGGCCAGAGAGGGACAGG + Intergenic
1104941377 12:132397143-132397165 TGAAAGGCCAGGAGGGGGCCCGG - Intergenic
1106917668 13:34532343-34532365 TGAAATGGGATGAGTGGGACAGG + Intergenic
1109151857 13:58857511-58857533 TGGAGGGGCAAGAGTAAGACTGG + Intergenic
1109378133 13:61524446-61524468 TGAAGGGGCAAGAGTGAGACTGG + Intergenic
1111133942 13:84014128-84014150 GGAAAGGACAAGAGTGGGTGAGG + Intergenic
1111292519 13:86187144-86187166 TGGAGGGGCAGGAGTGAGACTGG - Intergenic
1113301829 13:109030791-109030813 TGAGAGAGAAAGAGTGGGAGTGG - Intronic
1113469173 13:110532154-110532176 TGCCAGGGCAAGAGTGGGGCTGG + Intronic
1117284383 14:54272581-54272603 TGAAAGGACCAGAAGGGGACAGG + Intergenic
1117578984 14:57132210-57132232 TAAAAGGGCAAAAGTGGAGCTGG - Intergenic
1119445620 14:74661087-74661109 TGAAAGGGCAAGAGTGGGACAGG + Intronic
1120577896 14:86207082-86207104 AGAAAGGGAAAGAATGGGAAGGG - Intergenic
1120745104 14:88145362-88145384 TGTAGGGGCAAGAGTGAGACTGG - Intergenic
1122141189 14:99664045-99664067 TGCAAGGGACAGAGTGGGAGGGG + Intronic
1122295206 14:100701646-100701668 TGAAAAGGACAGAGTGGGAAGGG + Intergenic
1123187437 14:106533565-106533587 TGAAAGTGAAACAGTGGGACTGG + Intergenic
1123196902 14:106625805-106625827 TGAAAGTGTAACAGTGTGACTGG + Intergenic
1123205427 14:106708316-106708338 TGAAAGTGAAACAGTGGGACTGG + Intergenic
1123210474 14:106755583-106755605 TGAAAGTGAAACAGTGGGACTGG + Intergenic
1123804949 15:23861048-23861070 TGACAGGGCATGAGTGGACCAGG - Intergenic
1124037878 15:26072984-26073006 TGTCAGGGCAAGAGTGGGGTGGG - Intergenic
1125882552 15:43207139-43207161 TGAAACGGCAAGCGAGGGAAAGG - Intronic
1127031580 15:54870535-54870557 AGGAAAGGCAAGAGTGGGGCAGG - Intergenic
1127297594 15:57623164-57623186 CCAAAGTGCAAGAGTGGGTCAGG + Intronic
1127694683 15:61433681-61433703 TGAAAGTGAAACAGTGGGAGTGG - Intergenic
1128048329 15:64639711-64639733 TGGCAGGGGAAGGGTGGGACAGG + Intronic
1128756663 15:70187930-70187952 TGACAGGGCGAGAGTGTGGCAGG - Intergenic
1128772048 15:70290101-70290123 TTCAAGGGCAAGGGTGAGACAGG + Intergenic
1129138987 15:73579604-73579626 TTAAAGGTCAAGATTGGGAAGGG + Intronic
1129587462 15:76882957-76882979 TGAAAGAGCAGGAGAGGGCCGGG - Intronic
1132645425 16:997279-997301 TGAAGGGGCCAGTGTGGGACTGG - Intergenic
1132838650 16:1967443-1967465 TGGGAGGGCAGGAGTGAGACTGG + Intronic
1133012897 16:2924776-2924798 TGAACGGGCAAGAGTGGGAACGG + Intronic
1133848899 16:9483407-9483429 TGGAGGGGCAAGAGTGAGACAGG + Intergenic
1137892680 16:52179052-52179074 GGAAAGGGCAAGAGTGAGGTTGG - Intergenic
1137937603 16:52649486-52649508 AGAAAGGGCATGGGTGGAACTGG + Intergenic
1140206431 16:72937368-72937390 ACAAAGGGCAAGAGTGGCAAAGG + Intronic
1140978253 16:80081742-80081764 TAGAAGGGGAAGAGTGTGACCGG + Intergenic
1142472713 17:172231-172253 TGAGAGGGAAAGAGAGGGGCAGG - Intronic
1142495594 17:304938-304960 GGACAGGGCGAGAGGGGGACAGG + Intronic
1142495600 17:304954-304976 GGACAGGGCGAGAGGGGGACAGG + Intronic
1142495619 17:305001-305023 GGACAGGGCGAGAGGGGGACAGG + Intronic
1142495633 17:305033-305055 GGACAGGGCGAGAGGGGGACAGG + Intronic
1142495639 17:305049-305071 GGACAGGGCGAGAGGGGGACAGG + Intronic
1142495666 17:305112-305134 GGACAGGGCGAGAGGGGGACAGG + Intronic
1143405568 17:6675163-6675185 AGACAGAGCCAGAGTGGGACTGG + Intergenic
1143966540 17:10759578-10759600 TGAAACGGCAAGAATGGGTAAGG - Intergenic
1144301265 17:13924470-13924492 TGGAGGGGCAAGAGGGAGACTGG - Intergenic
1145877697 17:28332053-28332075 TCCAAGGGCAGGAGTGGGGCTGG - Intronic
1147150774 17:38512418-38512440 GGAAAGGGCCAGAGTGGGGCTGG + Intergenic
1147704021 17:42413699-42413721 TGGAAGCCCAAGAATGGGACTGG - Intronic
1148554431 17:48569789-48569811 TGAAGGGGCAAAAAAGGGACAGG + Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150057467 17:62031640-62031662 TGAAAGGAAAAAAATGGGACAGG + Intronic
1151832452 17:76562283-76562305 TGAAAGGGGAGGTGTGGGCCGGG + Intergenic
1151993191 17:77591746-77591768 TCACAGGGCAGGAGTGGGGCTGG + Intergenic
1153256770 18:3179517-3179539 TGAAATGGAGAGGGTGGGACTGG + Intronic
1155786975 18:29913886-29913908 TGGAGGGGCAAGAGTGAGACTGG - Intergenic
1155839810 18:30631008-30631030 TGTAGGGGCAGGAGTGAGACTGG + Intergenic
1156402411 18:36751857-36751879 TGAAAGGCACAGAGAGGGACTGG + Intronic
1156597807 18:38567337-38567359 TGAGAGGGCTGGAATGGGACAGG + Intergenic
1156605689 18:38664479-38664501 TGAATGGACAATAATGGGACAGG + Intergenic
1157096899 18:44693920-44693942 CAAATGGGCAAGAGTGGGAAGGG + Intronic
1157736634 18:50055252-50055274 TGAAACGGTAAGAGTGAGTCCGG - Exonic
1158452688 18:57580976-57580998 TGCAGGGGCAAGAGTGGAACTGG + Intronic
1158707717 18:59808349-59808371 TGAAAATGCAAAAGTGGGCCAGG + Intergenic
1159439570 18:68460109-68460131 TAAAAGGACAGGAGTGGGCCGGG + Intergenic
1160386312 18:78499071-78499093 TGTAAGGGAAAGAGTGGGTCTGG - Intergenic
1160550741 18:79692598-79692620 TGCAAGGGGAAGAGAGGGAAAGG - Intronic
1161750531 19:6092903-6092925 TGAGAGGCAAGGAGTGGGACGGG + Intronic
1163298106 19:16425342-16425364 TGAAGGGGCAAGGCTGGGGCCGG + Intronic
1163596957 19:18225968-18225990 TGTGAGGCCCAGAGTGGGACGGG - Intronic
1163691836 19:18742593-18742615 TGAATGGGCAAGAGAGGCACTGG - Intronic
1163842708 19:19621100-19621122 CCAAATGGCAACAGTGGGACGGG - Intergenic
1164598532 19:29546149-29546171 TGAAAGAGCCAGAGAGGAACAGG + Intronic
1164925078 19:32124176-32124198 TGGAGGGGCAAGAATGGGAAGGG + Intergenic
1165417926 19:35706280-35706302 GGCATGGGAAAGAGTGGGACAGG - Intronic
1166247436 19:41539000-41539022 AGGAGGGGCAAGAGTGAGACTGG - Intergenic
1167264755 19:48478045-48478067 TGAAAGGGAAGGGGTGGGAGGGG - Intronic
1168498396 19:56873306-56873328 TAAAAGTGGAAGAGTTGGACTGG - Intergenic
1168713994 19:58516670-58516692 TGAAAGGGGAAGAGTGCAACGGG + Exonic
925705918 2:6684705-6684727 TGGAGGGGCAAGAGTGAGAATGG + Intergenic
928077381 2:28277576-28277598 TGAAAGGGCAGGCATGGGGCGGG - Intronic
928620977 2:33087386-33087408 TGAAAGTGCAACAGTGGTAAAGG - Intronic
928999498 2:37332107-37332129 TGAAAGGGCATGCATGGGAATGG + Intergenic
929533904 2:42768670-42768692 TGGGAGGGCAAGAGTGGTGCAGG - Intronic
929750580 2:44708542-44708564 TGAAAGGCCAAGATTGTGATTGG - Intronic
929873478 2:45777194-45777216 TGAAACAGGCAGAGTGGGACTGG + Intronic
930021042 2:47002491-47002513 TGGAAGGGAAAGAGTGTGGCTGG + Intronic
930787749 2:55286977-55286999 TGAAAGGGGATGAGTAGGCCGGG - Intergenic
931803185 2:65778532-65778554 TGAATGGGAAAGAATGGGAAAGG - Intergenic
932024497 2:68119792-68119814 TGAAAGGGGAGGAGGGGGAAGGG - Intergenic
932749694 2:74363486-74363508 GGAAAGGGGAAGAGTAGGAATGG - Intronic
933709660 2:85315927-85315949 TGAATGGGAAAGAGTGGAAGAGG + Intergenic
933713408 2:85343847-85343869 TGAATGGGAAAGAGTGGAAGAGG - Intronic
934135882 2:88996089-88996111 TGAGAGGGACAGACTGGGACAGG + Intergenic
934672875 2:96226941-96226963 TGAAAAGGCAAGCCTGGAACTGG - Intergenic
935375141 2:102388110-102388132 AGAAACGGAAGGAGTGGGACAGG + Intronic
936147113 2:109987392-109987414 TGAAAGGGGAAGAGTGCGACAGG + Intergenic
936197579 2:110384091-110384113 TGAAAGGGGAAGAGTGCGACAGG - Intergenic
937023621 2:118679982-118680004 TAAAAGTGCAGGAGTGGGAGTGG - Intergenic
937731998 2:125243983-125244005 TGAATGGGCAAGAGAGAAACTGG - Intergenic
940519149 2:154720694-154720716 TGAGAGGGTAAGTGTGGGAAGGG + Intronic
940655605 2:156484423-156484445 TTAAAGAGAAAGATTGGGACTGG - Intronic
940903582 2:159148497-159148519 TGCATGGGCAACAGTGGTACTGG + Intronic
942832185 2:180250516-180250538 AGAGAGGGCAAGAATGGGGCAGG - Intergenic
943168166 2:184359623-184359645 TGAAAGAGAAAGAGAGTGACTGG - Intergenic
943441506 2:187932858-187932880 TGTAGGGGCAGGAGTGAGACTGG + Intergenic
944931304 2:204522838-204522860 TGAAAGGGCAAGGGGAGGAACGG - Intergenic
945385176 2:209189684-209189706 TGAAAGTGAAAGAGTGGAAAAGG - Intergenic
946165183 2:217859196-217859218 TGCAAGGGCCAGAGAGGGAGGGG + Intronic
947108147 2:226689554-226689576 TCAGAGGGAAAGGGTGGGACGGG + Intergenic
947345844 2:229188382-229188404 AGAAAGGGGAAGAGAGTGACTGG + Intronic
948373334 2:237504558-237504580 TGAAATGGCAGCAGTTGGACGGG + Intronic
1169519714 20:6357704-6357726 TTGAAGTGCAAGTGTGGGACAGG + Intergenic
1169816251 20:9659961-9659983 GGAAAGGGCAAGAATGGGCTTGG + Intronic
1169833597 20:9853072-9853094 TGAAAGAGAAAGAGTGGGTTTGG + Intergenic
1170441911 20:16387701-16387723 CGAAAGGCAAAAAGTGGGACAGG + Intronic
1170613140 20:17929986-17930008 AGAAAGGGCAAGACTGGAAGTGG + Intergenic
1170983651 20:21238668-21238690 TGAAAAGGCAACAGTGGGGTTGG - Intronic
1171008146 20:21488546-21488568 TAAATGGTCAACAGTGGGACAGG + Intergenic
1171091992 20:22294086-22294108 TGAAGGGTCGAGAGTGGGGCCGG + Intergenic
1172207420 20:33173798-33173820 TAAAAGTTCATGAGTGGGACCGG - Intronic
1172441707 20:34970808-34970830 TGGAAGGCAGAGAGTGGGACAGG + Intergenic
1172445010 20:34988437-34988459 TGAAAGGGCACGTGTGTGAGTGG + Intronic
1172848490 20:37944421-37944443 TGAAAGGGCAGGGGTGGGTGGGG - Exonic
1173030463 20:39353894-39353916 TGAAAGAGCAAGAGAGAGAGGGG + Intergenic
1173846587 20:46192536-46192558 TGAAGCTGCAAGAGTGGGAGTGG + Intronic
1174037837 20:47679053-47679075 AGGAAGGGCAGGAGGGGGACAGG - Intronic
1174147550 20:48462743-48462765 GGAAAGGGCAGGAGTGGACCCGG - Intergenic
1174367830 20:50067103-50067125 TGAGAGGGTAAGAGGGGGAAAGG - Intergenic
1174470973 20:50760614-50760636 CCAAAGGGCCAGAGTGGGGCAGG + Intergenic
1174782851 20:53406122-53406144 TGAAAGAGCAAGAGAGGATCAGG + Intronic
1174951976 20:55052125-55052147 TGAAAGGGAGAGAGAGAGACAGG + Intergenic
1177068263 21:16467054-16467076 AGAAAAGGCAAGAGTTGGAATGG - Intergenic
1177177135 21:17712339-17712361 TGAAAGAGAAAGAGGGGGAGGGG - Intergenic
1177186421 21:17802481-17802503 TAAAAGGGTAACAGTGGGCCAGG - Intronic
1178312240 21:31539241-31539263 TGACAGGGGAAGAGAGGGAATGG + Intronic
1178456821 21:32762540-32762562 TATATGGGAAAGAGTGGGACGGG + Intronic
1179349235 21:40591921-40591943 TTAAAGAGCAAGAAAGGGACAGG + Intronic
1179917802 21:44489008-44489030 TGGAGGAGCAAGAGTGAGACTGG - Intergenic
1180119124 21:45734802-45734824 TGACAGAGAAAGAGTGAGACTGG - Intronic
1180670345 22:17548275-17548297 AGAAAGGGAAACAGTGGGCCCGG + Exonic
1180693927 22:17739889-17739911 TGAGAGGGCAAAAGTGGGTCTGG - Intronic
1181961109 22:26622424-26622446 GGAAAGGACAGGAGAGGGACAGG + Intronic
1182295623 22:29309965-29309987 TGAAAGGTCATGTGTGGGCCGGG + Intronic
1182619318 22:31610152-31610174 TGGCAGGCCAAGGGTGGGACTGG + Intronic
949496833 3:4640412-4640434 AGGAAGTGCATGAGTGGGACTGG - Intronic
950122897 3:10493630-10493652 TGAAAGGGCAAGAGAGGATCTGG + Intronic
950632242 3:14290185-14290207 TGGCAGGGCATGAGTGGGACTGG - Intergenic
951624790 3:24647183-24647205 TGAAAGGGCAGAAGAGGGATGGG + Intergenic
952003226 3:28810191-28810213 TGGAGGGGCAAGTGTGAGACTGG + Intergenic
952391237 3:32882434-32882456 TCACATGGCAAGAGTGTGACAGG - Intronic
952865198 3:37850496-37850518 TCTAAGGGCAAGAGTGGGACAGG + Intergenic
952909035 3:38166246-38166268 AGAAAGTGCAGGTGTGGGACAGG + Intronic
953576705 3:44118496-44118518 AGCAAGGGCAAGTGTGGGTCTGG - Intergenic
954824067 3:53355799-53355821 GGAAAGGGAAAGAGTGGGGAGGG - Intergenic
956557780 3:70541373-70541395 TGGAGGAGCAAGAGTGAGACTGG + Intergenic
956834859 3:73088557-73088579 TGTAAGCGCAAGATTGGGTCAGG + Intergenic
957027332 3:75197374-75197396 TGAAAGAGCAAGCCAGGGACTGG + Intergenic
958176638 3:90003637-90003659 AGAAAGGACAAAAGTGGGCCCGG - Intergenic
958466974 3:94471315-94471337 TGGAGGGGCAGGAGTGAGACTGG + Intergenic
959254289 3:103990619-103990641 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
959600007 3:108171228-108171250 TGAAATGACAAGGGTGAGACTGG - Intronic
959782654 3:110254833-110254855 TGAAAAAGCAAGATTGGGGCCGG - Intergenic
959895034 3:111595653-111595675 TGAAGGAGGAAGAGTGGGAAAGG + Intronic
960062469 3:113338792-113338814 TGGAGGGGCAAGAGTGAGACTGG + Intronic
960609066 3:119538472-119538494 GGTAAGGGAAAGAGAGGGACAGG - Intronic
961343348 3:126245215-126245237 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
961402965 3:126660125-126660147 TGAAACTGCAAGACAGGGACTGG - Intergenic
961702493 3:128757144-128757166 TGTATGTACAAGAGTGGGACTGG - Intronic
963761431 3:149290038-149290060 TGGAGGGGCAAGATTGAGACTGG - Intergenic
964920753 3:161892583-161892605 AGAAAGGGCTAGAGAGGGAAGGG + Intergenic
965300470 3:167000307-167000329 TTGGAGGGCAAGAGTGAGACTGG + Intergenic
965663792 3:171069923-171069945 TGAACAGGAAAGAGTGGAACTGG - Intronic
966211987 3:177463121-177463143 TGAAAGGGCATGAGTAGCAGTGG + Intergenic
968135037 3:196214986-196215008 TGAAAGGGCAGGAGGGAGCCGGG - Intronic
968572649 4:1350212-1350234 TTAAAGTGCAAGGTTGGGACAGG - Intronic
968683483 4:1938606-1938628 TGAAAGGGGAAGGCTGGGGCTGG + Intronic
969265920 4:6064018-6064040 GGGAAGAGCAAGAGTGGGAAGGG - Intronic
969521583 4:7680901-7680923 TCAAAGTGCAAGGTTGGGACAGG - Intronic
970266810 4:14297354-14297376 TGAAAGAGCCAAAGTTGGACTGG + Intergenic
971232329 4:24809693-24809715 TGACAGAGCCACAGTGGGACTGG + Intronic
971430240 4:26557691-26557713 TGATAGGGCAAGAGTTTGATGGG - Intergenic
972841448 4:42934593-42934615 TGATAGAGCAAGTGTAGGACTGG - Intronic
972918200 4:43905544-43905566 TGGAGGGGCAAGAGTGAGATTGG - Intergenic
973926350 4:55742378-55742400 TGGATGGGGAAGAGTGGGAGGGG + Intergenic
975386932 4:73769043-73769065 TGGAGGGGCAAGAGTGGGACTGG - Intergenic
979188923 4:117833627-117833649 TGAAGGGGCAAGAGTGAAACTGG + Intergenic
979654518 4:123176773-123176795 GGTAAGGGAAAGAGTGGGAGAGG + Intronic
979919720 4:126480918-126480940 TGAAGGGGCAAGAGTGAGACTGG - Intergenic
979987094 4:127328519-127328541 GGAAAGGGGAAGAGTTGGAGAGG - Intergenic
980327812 4:131371139-131371161 TGTAAGGGAAAGAGTGCCACTGG + Intergenic
980495834 4:133586908-133586930 TTGGAGGGCAAGAGTGAGACTGG - Intergenic
980660949 4:135856761-135856783 TGAAAGGGAAAGAGTGTGTTTGG - Intergenic
980716831 4:136638630-136638652 TGGAGGGGTAAGAGTGAGACTGG - Intergenic
981052808 4:140327820-140327842 TGAAATGGCAAGTTTGGGGCTGG + Intronic
982210759 4:153033628-153033650 TGAATGGGGAAGAGAGGGTCAGG - Intergenic
982358477 4:154493253-154493275 TAAAGGGGCAAGAGTGGGAGGGG - Intergenic
982537228 4:156621857-156621879 TAAAAAGGAAAGAGTGGGCCCGG + Intergenic
982971060 4:161987100-161987122 AGAAAGGGTTAGATTGGGACAGG - Intronic
983107143 4:163701194-163701216 TGCAAGGGCAAGAGGGGAAATGG - Intronic
984495264 4:180488907-180488929 TAAAAGGGCAAGACTGGGGCTGG - Intergenic
984851419 4:184156355-184156377 TGAAAGAGCAAGAGAGGCAGAGG - Intronic
984880296 4:184404846-184404868 GGAGGAGGCAAGAGTGGGACAGG + Intronic
985588150 5:751399-751421 CGCAAGGGCAGGTGTGGGACAGG + Intronic
987106587 5:14645750-14645772 TGAAAGGGAAAGAGGGGGGATGG + Intergenic
987585836 5:19855039-19855061 TGCAACAGCATGAGTGGGACTGG - Intronic
987934394 5:24445475-24445497 TGAAAGGACAAGAGAAGGAAAGG - Intergenic
988925781 5:35990244-35990266 TGAGAGGGCAACTGAGGGACAGG - Intronic
989396575 5:40963519-40963541 TGATAGAGCCAGAGTGGGCCAGG + Intronic
989606342 5:43247610-43247632 TGATTGGTCTAGAGTGGGACTGG + Intronic
990439063 5:55825501-55825523 AGAAAGGGAAAGAGTTGGAGAGG + Intergenic
991036068 5:62129012-62129034 TGAAAGGCCTAGGGTGGGACTGG - Intergenic
992022048 5:72634409-72634431 TTAAAAGGCATGAGTGGGAAGGG + Intergenic
993658125 5:90597525-90597547 TGAAAGGATAAGAGTTGCACTGG + Intronic
994245000 5:97468541-97468563 TGTAGGGGCAGGAGTGAGACAGG + Intergenic
995980990 5:118104089-118104111 TGAAAGAGAAAGAATGGGAGAGG + Intergenic
996020098 5:118581313-118581335 TGGAAGGGCAAGAGTGCTTCAGG + Intergenic
996042786 5:118834389-118834411 CAAAAGGGCAAGAGTGTAACAGG + Intergenic
996762312 5:126998760-126998782 TGACAGGGAGAGAGTGGGACAGG - Intronic
998834567 5:146191196-146191218 AGAAAGGGAAAGAGGGAGACAGG + Intergenic
999223381 5:150000322-150000344 TGAGAGGGAAAGACTGAGACAGG + Intronic
1000765031 5:165277020-165277042 TGAAGGGGCAAGATGGGGTCTGG - Intergenic
1001052722 5:168425878-168425900 TGAAATGGCAAGACCAGGACTGG + Intronic
1001116118 5:168941617-168941639 TGAAAGGGCAAGTCAGAGACTGG - Intronic
1002000667 5:176194830-176194852 TGCAAGGGCAGGAGCGGGGCGGG + Intergenic
1002253672 5:177944151-177944173 TGCAAGGGCAGGAGCGGGGCGGG - Intergenic
1003011654 6:2432864-2432886 TTAAAGGGCAGGACTGGGAGTGG - Intergenic
1003939465 6:11009886-11009908 GGAAGGGGCAAGAGTGGAAGAGG + Intronic
1004406589 6:15338755-15338777 TGGAAGGGAAAGAGTGAGACTGG - Intronic
1004976930 6:20978393-20978415 TGAAATGGCAAGACTGTGAAAGG - Intronic
1005224505 6:23626202-23626224 GGAAAGGGCTAGAGTGTGGCTGG - Intergenic
1005873450 6:29994510-29994532 TGGAAGGGCAGGAGGGGGTCAGG - Intergenic
1006208669 6:32374309-32374331 TGGAGGGGCAAAAGTGAGACTGG - Intergenic
1006270096 6:32957794-32957816 TTAAATGGCAAGAATGGGAGCGG - Intronic
1006369030 6:33633200-33633222 TGAGATGGCAGGAGTGGGATGGG + Intronic
1006586867 6:35120874-35120896 TGTGAGGGCAGGAGTGGGAAAGG - Intronic
1006970886 6:38043611-38043633 TGAAAGGGGAAGAGCGGGAGAGG - Intronic
1007289234 6:40772697-40772719 GGTAAGGGCAGGAGTGGGACGGG - Intergenic
1007474015 6:42107241-42107263 AGAAAGGCCAAGGGTGGGGCAGG + Exonic
1007582863 6:42969560-42969582 TGAACTGGCCAGAGTGGGATTGG - Intronic
1007686118 6:43668338-43668360 TGAGAGGACAGGAGTGTGACAGG + Intronic
1007878438 6:45134183-45134205 TGAAAGGGCAAGAGAGTGCAAGG + Intronic
1008094468 6:47325052-47325074 AGAACTGGCAAGAGTGGGCCGGG - Intergenic
1009032256 6:58073583-58073605 TGTCAGGGGAAGAGTGGAACCGG - Intergenic
1009344650 6:62598108-62598130 TCAAAGTGCATGAATGGGACAGG - Intergenic
1009626651 6:66144662-66144684 TGGAGGGGCAACAGTGAGACTGG + Intergenic
1011150522 6:84267773-84267795 TGAGAATGCAAGAGTGGGAATGG + Intergenic
1011325959 6:86150341-86150363 TGGAGGGGCAGGAGTGAGACTGG + Intergenic
1011921798 6:92586659-92586681 TGTAAGGGCAGGAGTGGGAGGGG + Intergenic
1012267285 6:97161174-97161196 TGAGAGGGCAAGAGGAGGAGTGG - Intronic
1014277079 6:119399464-119399486 TGGAGGGGCAAGAGTGAGACTGG + Intergenic
1015944775 6:138488792-138488814 TGAAAGGGCATCAAAGGGACAGG + Intronic
1016422382 6:143899028-143899050 TGAAACTGCCTGAGTGGGACAGG + Intronic
1016807400 6:148225566-148225588 TGAAGGGGAAAGGGTGGGAGGGG + Intergenic
1019042721 6:169119872-169119894 TGGAAGGGCAAGAGTGAGACTGG - Intergenic
1019635360 7:2072694-2072716 TGCAAAGGCAAGAATGTGACAGG + Intronic
1020275920 7:6624388-6624410 AGAAAGGGGAAAAGGGGGACGGG - Intergenic
1021054037 7:16024883-16024905 TGAAAGGAAAAGAATGGGAGAGG - Intergenic
1021180816 7:17503727-17503749 TGAAAGGGCAGGAAAGGGCCAGG + Intergenic
1021206423 7:17786632-17786654 TGGAAGGGCAGGAGGGGGTCAGG + Intergenic
1021476579 7:21068442-21068464 TGAAAGGGAAACAGAGAGACTGG + Intergenic
1021794996 7:24245590-24245612 TGAAAGGGCAAGGGGAGGAGAGG + Intergenic
1021820865 7:24496358-24496380 TGAAAGGGACAGAGTGGAGCAGG - Intergenic
1023763097 7:43485137-43485159 GGAAAGGGCAAGAGTCTGACAGG + Intronic
1023979885 7:45062935-45062957 TGGAAGGGCAGGAGAGGGAAGGG + Intronic
1024264887 7:47598863-47598885 TGGAGGGGCAAAAGTGAGACTGG - Intergenic
1024830598 7:53450747-53450769 TGAAATAGCAAAAGTGGGAAGGG + Intergenic
1025110746 7:56214106-56214128 TCCAAGGGGAAGAGTGGGAAGGG - Intergenic
1026830987 7:73610021-73610043 GGAAAGGGCCAGAGTGAGAGAGG - Intronic
1028362835 7:89989652-89989674 TGAATGGGTAAGAGTAGGAGGGG + Intergenic
1028423007 7:90654158-90654180 AGAAAGGACAGGAGTGGGAAAGG - Intronic
1029231652 7:99074616-99074638 TGAAAGGGCAAGAGACAGACTGG + Intronic
1030045248 7:105489446-105489468 TGAAGGGGCAGGAGTGGGTAAGG - Intronic
1030129508 7:106186141-106186163 AGAAAGGGAAGGAGTGGGAAAGG - Intergenic
1030485939 7:110167725-110167747 TGGAAGGGGGAGAGTGGGAGTGG - Intergenic
1032484695 7:132276609-132276631 GCAAAGGGGAAGAGTGGGAACGG - Intronic
1032614406 7:133451028-133451050 AGACAGTGCAAGAGTGGGAAAGG + Intronic
1032917831 7:136511592-136511614 TGGAGGGGTAAGAGTGAGACTGG + Intergenic
1033412444 7:141130964-141130986 TGAAATGGCAGCAGTGGGAGAGG - Intronic
1033610495 7:142959864-142959886 TGATGGGGAAAGAGTGGGAGGGG - Intronic
1037841963 8:22251233-22251255 GGAAGGGGCAAGAGTGGGGACGG - Exonic
1038024610 8:23577505-23577527 TGAAACAGAATGAGTGGGACTGG + Intergenic
1038150657 8:24940494-24940516 TGCCAGAGCAAGGGTGGGACAGG - Intergenic
1038231096 8:25701076-25701098 AGAAAAGGGAAGGGTGGGACAGG - Intergenic
1039659885 8:39450002-39450024 TGGAAGGGCAAGAGTGAGACTGG - Intergenic
1041935148 8:63324998-63325020 TGGAGGGGCAAGAATGAGACTGG - Intergenic
1043204194 8:77415570-77415592 GGAAAGGATAAGAGAGGGACAGG - Intergenic
1044893146 8:96858589-96858611 TGAAAGGGCAGGAGAGAGACTGG - Intronic
1045339895 8:101244283-101244305 TTGAAGGGCAAGAGTGGAAGTGG - Intergenic
1045498609 8:102728620-102728642 GGGAAGGACAACAGTGGGACTGG - Intergenic
1046138697 8:110062449-110062471 TGAAGGGGCAAGAGTGAGACTGG - Intergenic
1048859641 8:138714557-138714579 AGGAAGAGCAAGAGTGGGAAAGG - Intronic
1049215760 8:141407223-141407245 GGAGAGGGCAGGAGAGGGACTGG - Intronic
1050384546 9:5073458-5073480 AGAGAGAGCAAGAGTGGTACAGG - Intronic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1053147934 9:35724520-35724542 TGAAATGGGAAGGGTGGGAAGGG - Intronic
1053312700 9:37029506-37029528 TGAAAGGGGAAGATCCGGACAGG - Intronic
1054992910 9:71351034-71351056 GAAAAGGCCAAGAGTGTGACAGG + Intronic
1055375678 9:75646778-75646800 TGGAGGGCCAAGAGTGAGACTGG + Intergenic
1055728169 9:79253920-79253942 TGAGAGGTCAAGAGTGAGAGCGG - Intergenic
1056252162 9:84760749-84760771 GGAAAGGGCAGGAATGGGAGGGG + Intronic
1056256760 9:84807305-84807327 TCAAAGGGAAAGACTGGGAAGGG - Intronic
1056517718 9:87371118-87371140 TGAAAGAGAAAGAGAGAGACAGG - Intergenic
1056826440 9:89879389-89879411 GGAAAGGGCAGGATAGGGACCGG - Intergenic
1057948638 9:99352082-99352104 TGCATGGGCAAGAGTGGCACAGG + Intergenic
1058776156 9:108285888-108285910 AGAAAGGGCAAGAGTTAGCCAGG + Intergenic
1058828460 9:108795160-108795182 TGGAAGGGCAAGAGTGAGACTGG - Intergenic
1060294036 9:122331070-122331092 AGAAAGGGCAAAACTGCGACAGG - Intergenic
1060608616 9:124940824-124940846 TGAAAGGGTGAGAGTGGGGGCGG - Intronic
1060941853 9:127547015-127547037 AGAAAGGCCAAGATTCGGACAGG + Intronic
1061338200 9:129957331-129957353 TGAAAGCTCAAGTGTGGGCCGGG - Intronic
1062275218 9:135727292-135727314 AGAATGGGAAAGAGAGGGACAGG - Intronic
1185539605 X:891926-891948 TGAAAAGGCAAGACTGGGTTGGG + Intergenic
1186471865 X:9827970-9827992 TTAAAGGGCAGGACTGGGGCAGG - Intronic
1187510071 X:19909784-19909806 TCAAAAGGAAAGAGTGGAACTGG - Intergenic
1188665477 X:32814680-32814702 TGACAGAGAAAGAGTGGGTCAGG + Intronic
1189414697 X:40803705-40803727 TGGAGGGGCAAGAGTGAGACGGG + Intergenic
1189907793 X:45779701-45779723 TCGAAAGGCAAGAGTGGAACAGG + Intergenic
1190756135 X:53403723-53403745 TGTCAGGGCAGGACTGGGACTGG - Intronic
1192236405 X:69299017-69299039 TGAAAGGGCAAGTGTGGGCACGG - Intergenic
1192396580 X:70787622-70787644 CGAAATGGCAAGAGGGGGCCGGG - Intronic
1192797873 X:74439595-74439617 AGAAAGCGCAAGAGTGAGGCTGG - Intronic
1193680750 X:84516280-84516302 TCAAAGGGAAAGGGTGGGAATGG - Intergenic
1195129908 X:101841399-101841421 TGACAGGGAAAGAGGGGGCCAGG + Intronic
1195176316 X:102318385-102318407 TGACAGGGAAAGAGGGGGCCAGG - Intronic
1195182548 X:102368708-102368730 TGACAGGGAAAGAGGGGGCCAGG + Intronic
1195667175 X:107441924-107441946 TGAGAGGGAAAGAGAGGGAGAGG - Intergenic
1196098590 X:111825551-111825573 TGAAAGTCCTAGAGTGGGCCGGG - Intronic
1196520775 X:116668243-116668265 TGCAAGGGCAAGACTGAGACTGG - Intergenic
1196687071 X:118520236-118520258 TGAAAGGGCAAGGGATTGACTGG + Intronic
1196906584 X:120443009-120443031 TGAAAAGGAAAGATTAGGACTGG - Intronic
1198949333 X:142053071-142053093 TGAGAGGGGAAGAGTGAGAGGGG - Intergenic
1199679494 X:150215342-150215364 AGAAAGGGGAAGAGAGGGAGGGG + Intergenic
1199695737 X:150341707-150341729 AGAAAGGGAAAGAGAGGGAGGGG - Intergenic
1200054270 X:153450561-153450583 TGTCAGTGCAAGAATGGGACAGG - Intronic
1201334502 Y:12865661-12865683 TGAAAGGGGAAAATTGGGCCGGG - Intergenic
1201924438 Y:19269288-19269310 TAGATAGGCAAGAGTGGGACAGG - Intergenic