ID: 1119449178

View in Genome Browser
Species Human (GRCh38)
Location 14:74693710-74693732
Sequence AAAGCAGGGATTCTGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 405}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119449178_1119449183 8 Left 1119449178 14:74693710-74693732 CCTGGACCCAGAATCCCTGCTTT 0: 1
1: 0
2: 2
3: 29
4: 405
Right 1119449183 14:74693741-74693763 ACTCTACTGCCTCTCCACTATGG 0: 1
1: 1
2: 0
3: 13
4: 109
1119449178_1119449184 9 Left 1119449178 14:74693710-74693732 CCTGGACCCAGAATCCCTGCTTT 0: 1
1: 0
2: 2
3: 29
4: 405
Right 1119449184 14:74693742-74693764 CTCTACTGCCTCTCCACTATGGG 0: 1
1: 0
2: 1
3: 7
4: 134
1119449178_1119449186 18 Left 1119449178 14:74693710-74693732 CCTGGACCCAGAATCCCTGCTTT 0: 1
1: 0
2: 2
3: 29
4: 405
Right 1119449186 14:74693751-74693773 CTCTCCACTATGGGAAACCAAGG 0: 1
1: 0
2: 1
3: 63
4: 1570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119449178 Original CRISPR AAAGCAGGGATTCTGGGTCC AGG (reversed) Intronic
900821954 1:4896641-4896663 AAACCATAGGTTCTGGGTCCAGG + Intergenic
901170288 1:7252135-7252157 AACCCAGCAATTCTGGGTCCAGG - Intronic
901215523 1:7552749-7552771 AAAGCAGGGAGGCTGGGTTAGGG + Intronic
902705444 1:18201107-18201129 AAAGAAGGCATTCTGGGTAGAGG + Intronic
903337887 1:22636944-22636966 AGACCAGGGTTCCTGGGTCCTGG + Intronic
903366138 1:22806563-22806585 GAAGCTGGGATCCTGGGGCCTGG - Intronic
903805074 1:25999423-25999445 AAAGCAGGGACTCTGGACCCTGG - Intergenic
904285784 1:29452521-29452543 GGAGCAGGGAATCTGGGTCTGGG + Intergenic
904299912 1:29547584-29547606 AACCCAGGGATTCTGGCCCCAGG + Intergenic
904313898 1:29647346-29647368 GAGGCAGGGAATCTGGGTCCTGG + Intergenic
904378737 1:30097292-30097314 CAGGCAGGGATTCTGGGGCTGGG + Intergenic
904405363 1:30284901-30284923 AACCCAGGGATTCTGGCCCCAGG - Intergenic
904604823 1:31692555-31692577 AGGGCAGGGATGGTGGGTCCAGG - Intronic
905472333 1:38202939-38202961 AAAGCAGGCAGTCTGGCTCCAGG + Intergenic
905923908 1:41736529-41736551 AAAGTAGCCATCCTGGGTCCTGG + Intronic
906089127 1:43163055-43163077 GAAGCGTGGATTCTGGGGCCTGG - Intergenic
906321125 1:44817216-44817238 AATGCAAGCATTCTGGCTCCAGG - Intergenic
906942956 1:50272044-50272066 AAAGAGGGGATGCAGGGTCCAGG - Intergenic
907112196 1:51936212-51936234 TGAGCAGGGACACTGGGTCCTGG + Intronic
908737185 1:67289189-67289211 AAATCAGGGATTCTCTGTCCTGG + Intergenic
909025958 1:70482537-70482559 AAAGCAAGGAGTCAGGGTCCTGG + Intergenic
909549338 1:76880056-76880078 AACTCAGGGATTCTGTCTCCTGG - Intronic
909576523 1:77182969-77182991 AACTCAGGGATTCTGTCTCCCGG + Intronic
910255739 1:85245577-85245599 AACCCAGGCATTCTGGCTCCGGG - Intergenic
911057113 1:93718451-93718473 AGGGCAGGGATTCTGGGGTCAGG + Intronic
912847830 1:113092069-113092091 GAAGCAGTGAATCTGGGGCCAGG - Intronic
912944226 1:114071113-114071135 AACTCAGGGATTCTGTCTCCTGG - Intergenic
913659393 1:120993175-120993197 AAGAGAGGGATTCTGGGTACTGG - Intergenic
913695495 1:121321162-121321184 AACGCAGGGAAACTGGGTCCTGG + Intronic
914010755 1:143776299-143776321 AAGAGAGGGATTCTGGGTACTGG - Intergenic
914142070 1:144958898-144958920 AATGCAGGGAAACTGGGTCCTGG - Intronic
914167073 1:145184816-145184838 AAGAGAGGGATTCTGGGTACTGG + Intergenic
914649377 1:149684956-149684978 AAGAGAGGGATTCTGGGTACTGG - Intergenic
915316697 1:155032878-155032900 GAAGCCTGGATTCTGGGGCCTGG + Intronic
916046936 1:161006845-161006867 AACGCAGGCAGTCTGGTTCCAGG - Intronic
918101966 1:181384122-181384144 GATGCAAGGATTCTGGTTCCTGG + Intergenic
918377294 1:183922063-183922085 AAACCAGGGATCCTGGCTCTTGG + Intronic
919081997 1:192878300-192878322 AAAGCAAGCACTCTGGGTACTGG + Intergenic
919241424 1:194921602-194921624 AACTCAGGGATTCTGTCTCCTGG + Intergenic
919946139 1:202320200-202320222 ATAGTAGGGTTCCTGGGTCCTGG + Intergenic
919964185 1:202504742-202504764 AATGCAGGGAGTCTAGCTCCTGG - Intronic
920482824 1:206339545-206339567 AATGCAGGGAGACTGGGTCCTGG + Intronic
920956630 1:210625773-210625795 AAAACAAAGATTCTAGGTCCTGG - Intronic
921180691 1:212629328-212629350 AGAGGAGGGATTCTGGGACACGG + Intergenic
921358395 1:214307739-214307761 GAATCTGGGATTCTAGGTCCTGG - Intronic
921995501 1:221413558-221413580 AATGCAGGGCTTATGGGTGCTGG + Intergenic
922462655 1:225825139-225825161 AAAGAAGGGAATCTGGGACAAGG - Intronic
923054190 1:230413262-230413284 CAAGCTGGGAGTCTGGTTCCGGG - Intronic
923548121 1:234939558-234939580 AAAGCAGTGGTTCTAGATCCTGG + Intergenic
924070493 1:240273402-240273424 AACACAGGCATTCTGGGTCCAGG + Intronic
1062931605 10:1356488-1356510 GAAGCTGAGGTTCTGGGTCCTGG - Intronic
1065841258 10:29703387-29703409 AGAGCAGGGTTTCTGGCACCAGG - Intronic
1067534811 10:47101276-47101298 AGAGCAGGGATTCAGAGGCCAGG + Intergenic
1067754790 10:48996937-48996959 AACTCAGGGATTCTGCCTCCTGG - Intergenic
1068170168 10:53382591-53382613 AAAGGAAGGATCTTGGGTCCTGG - Intergenic
1069729677 10:70602614-70602636 AGAGCAGGGATTGGGGGGCCTGG - Intronic
1070772307 10:79089574-79089596 AAATTAGGGGTTCTGGGTGCAGG + Intronic
1071943169 10:90610683-90610705 AACTCAGGGATTCTGTCTCCTGG - Intergenic
1072234751 10:93443935-93443957 AAAGTTGGGATTCTGGAGCCAGG - Intronic
1072305046 10:94099246-94099268 AAAGCAGGCATCATGGGCCCTGG + Intronic
1073055741 10:100699991-100700013 AGATCAGGGAGTCTGGGTCATGG - Intergenic
1073133996 10:101209527-101209549 AAAGCATGGACTCTGGAACCTGG - Intergenic
1073662747 10:105495289-105495311 AAAGCAGTGACTCTGCGACCTGG + Intergenic
1074538898 10:114348700-114348722 AAAGCAGTGATTCTCAGCCCGGG + Intronic
1075941659 10:126395292-126395314 GAAGAAGCGATTCTGGGTCTGGG + Intergenic
1076160896 10:128243389-128243411 AAAGCAGGGAATCTGACCCCAGG + Intergenic
1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG + Intronic
1076927795 10:133502140-133502162 AACTCAGGGATTCTGTCTCCTGG - Intergenic
1078740390 11:14060549-14060571 TAACCAGGGATTCTTGGCCCTGG + Intronic
1079532164 11:21467143-21467165 AAAGCAAGGATTCTGGAGTCAGG + Intronic
1080497446 11:32833754-32833776 AAAGCAGGGATGTTGGTTCTTGG - Intronic
1081608649 11:44544927-44544949 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1083334881 11:61916794-61916816 GTAGCAGAGACTCTGGGTCCTGG - Intronic
1083968746 11:66059362-66059384 GAAGCAGGGACTCTGGGCACAGG + Intronic
1084651990 11:70494919-70494941 CCAGCAGGGCTTGTGGGTCCAGG - Intronic
1085685565 11:78619273-78619295 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1086351800 11:85949838-85949860 CAAGCAGGAGTTCTTGGTCCTGG - Intergenic
1088532791 11:110828788-110828810 AAAGCAAGGATTCATGGCCCAGG + Intergenic
1089761024 11:120723436-120723458 GATCCAGGGCTTCTGGGTCCTGG - Intronic
1089784026 11:120895156-120895178 AGACCAGGGAGTCTGGGGCCGGG + Intronic
1090075037 11:123575217-123575239 TTAGCAGGGATTCTGGGTTTGGG + Intronic
1090078750 11:123596245-123596267 AATTCAGGTATTCTGGCTCCAGG - Intronic
1090900732 11:131028529-131028551 AAAGCAGGACTTCTAGGTCCCGG - Intergenic
1091119279 11:133043208-133043230 CCAGCTGGGATTGTGGGTCCAGG + Intronic
1091205297 11:133816900-133816922 AGAGCAGGGACTCTGGGACGGGG - Intergenic
1091979632 12:4854603-4854625 ATTACAGTGATTCTGGGTCCAGG + Intergenic
1092988683 12:13873780-13873802 TAAACAGGGATCCTTGGTCCTGG + Intronic
1093049278 12:14487780-14487802 AACTCAGGGATTCTGTCTCCTGG - Intronic
1093371866 12:18375747-18375769 AAAGAATGGTTTCTGGGGCCAGG + Intronic
1096070865 12:48774851-48774873 CAAGCAGGGATGCAGGCTCCAGG + Intronic
1097180228 12:57167629-57167651 CCAGCAGGGATTCAGTGTCCTGG - Intronic
1098164755 12:67683150-67683172 AACGCAGGTGTTCTGGCTCCAGG - Intergenic
1098749456 12:74276569-74276591 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1098805070 12:75013150-75013172 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1101435637 12:104661742-104661764 AAACCAGGCATCCCGGGTCCTGG - Intronic
1102227321 12:111237859-111237881 AATGCAGGGGTTCTGAGTGCTGG + Intronic
1102566330 12:113799714-113799736 AAGTCAGGGAATCTGGCTCCAGG - Intergenic
1103733378 12:123043224-123043246 GAAGCTGGGAGTCAGGGTCCTGG - Intronic
1103896051 12:124273969-124273991 AAAGCAGAGATCTTGGGTCTGGG + Intronic
1104622982 12:130332185-130332207 AAAGCAGGGTTGCTGGGGCTGGG - Intergenic
1105270659 13:18872209-18872231 AAAGCAAGGATTCTTGGGACTGG - Intergenic
1106169940 13:27280264-27280286 AAACCAGGATTTCTGGCTCCAGG + Intergenic
1106674848 13:31947700-31947722 AAAGCAGGAATGCTGGCTGCAGG - Intergenic
1109066211 13:57695918-57695940 TAAGCAGAAAATCTGGGTCCTGG + Intronic
1111940290 13:94600732-94600754 AAGTAAGGGATTCTGGTTCCAGG + Intergenic
1112225304 13:97533648-97533670 AGAGCAGGGATTCTGGACGCAGG + Intergenic
1112250318 13:97773140-97773162 AACTCAGGGATTCTGTCTCCCGG - Intergenic
1113425707 13:110206654-110206676 AAAGCACTTACTCTGGGTCCTGG + Exonic
1113938750 13:114007883-114007905 TAAGCAGGGAATCTGGGTCCCGG + Intronic
1114422879 14:22599100-22599122 AAAACAGGATTACTGGGTCCAGG - Intronic
1114610018 14:24033966-24033988 AGAGCAGGAAATCTTGGTCCGGG - Intergenic
1115957468 14:38797559-38797581 TAAGCAGGCAGTCTGGATCCAGG + Intergenic
1118300632 14:64612674-64612696 AGAGCATGGACTCTGGGGCCTGG + Intergenic
1119060134 14:71465364-71465386 AATTCAGGGATTCTGTCTCCTGG - Intronic
1119449178 14:74693710-74693732 AAAGCAGGGATTCTGGGTCCAGG - Intronic
1119567318 14:75639770-75639792 GAACCAGAGACTCTGGGTCCTGG + Intronic
1120082412 14:80230463-80230485 AATTCAGGGATTCTGTCTCCTGG - Intronic
1120184754 14:81383189-81383211 AAACCAGGCAGTCTGGATCCAGG - Intronic
1120704545 14:87733676-87733698 AAAACAGGGCTGCTGGGTCAGGG - Intergenic
1121903967 14:97723000-97723022 AAAGGAGGGATCTTGGCTCCAGG + Intergenic
1122487506 14:102090900-102090922 GGAGCATGGATTCTGGATCCAGG + Intronic
1122516817 14:102314649-102314671 ACCGCAGGGATCCTGGGTGCGGG + Intergenic
1122919449 14:104874037-104874059 CAGGCAGGGATCCTGGGGCCTGG + Intronic
1123017287 14:105381468-105381490 AAAGCAGCGAGTCTGGGCACTGG + Intronic
1123467574 15:20528172-20528194 ACGGCAGGGATTCTGGGGGCTGG - Intergenic
1125447219 15:39771208-39771230 AAAGCAGGGATCATAGGCCCTGG + Intronic
1126076055 15:44910965-44910987 AAATTAGGGGTTCTGGGGCCAGG + Intergenic
1127831764 15:62757221-62757243 AAAGCAGGGGCTCTGGGGCCTGG - Intronic
1127853539 15:62935802-62935824 AGAGCAGTGCTGCTGGGTCCTGG - Intergenic
1128746748 15:70120146-70120168 ACAGCAGGAACTCTGGGCCCAGG + Intergenic
1129263987 15:74384191-74384213 AAGGCAGGACTCCTGGGTCCCGG + Intergenic
1129826608 15:78638660-78638682 ACAGCAGGGATACTGGGGACTGG + Intronic
1130664125 15:85854880-85854902 CAAGCAGGGATCCTGGGGCTGGG + Intergenic
1131258371 15:90875962-90875984 AAGACAGGGATTCTGGGAGCAGG + Intronic
1132220193 15:100099614-100099636 AAAGCAGGGCTTCAAGTTCCTGG + Intronic
1133619573 16:7513478-7513500 AAAGTAGGGATTCTGGACCTTGG + Intronic
1134387769 16:13789917-13789939 AAACCAGGCATCCTGGATCCAGG - Intergenic
1137645477 16:50069664-50069686 AAAGCAGGGCTTCTCAATCCAGG - Intronic
1138633096 16:58315042-58315064 AAATAAGGGATTCTGCCTCCTGG + Intronic
1139478293 16:67214238-67214260 GAAGCAGGCCTTCTGGGTTCTGG + Intronic
1140597801 16:76436561-76436583 AACTCAGGGATTCTGTCTCCTGG - Intronic
1141996346 16:87638649-87638671 AGAGCAGGGACCCCGGGTCCCGG - Intronic
1143245803 17:5484991-5485013 AAAGCAGTGATTCTGCAGCCTGG - Intronic
1143884451 17:10055442-10055464 AAAGCAGGAAGTCTGGGAACAGG - Intronic
1144037098 17:11376866-11376888 AAATCCGGGATTCTGGAGCCGGG + Intronic
1144482394 17:15638777-15638799 AAGGATGGGATTCTGGGCCCAGG + Intronic
1144916289 17:18726255-18726277 AAGGATGGGATTCTGGGCCCAGG - Intronic
1147384666 17:40074241-40074263 CAAGCTGGGTTTGTGGGTCCCGG - Exonic
1147450255 17:40499894-40499916 TAAGCAGGTATACTGGGTCCTGG - Intronic
1149259581 17:54864305-54864327 AAACCAGGGAATGTGGATCCAGG - Intergenic
1150508244 17:65720962-65720984 AAAGCATGGATTCTGGAACCAGG - Intronic
1150550517 17:66205376-66205398 AAAGAAGGAATTCAGAGTCCTGG + Intergenic
1150732770 17:67710316-67710338 GAAGCTGGGATTATGGGTGCCGG - Intergenic
1152315021 17:79575143-79575165 AGATCAGGGGTTCTGGGCCCAGG - Intergenic
1153172193 18:2328883-2328905 AGAGGAGGGGTTCTGGGTTCAGG - Intergenic
1153902346 18:9628905-9628927 GGAGCAGGGCTTCTGGGTCTTGG + Intergenic
1154068088 18:11128211-11128233 AACTCAGGGATTCTGTCTCCAGG + Intronic
1154417384 18:14187744-14187766 AAAGCAAGGATTCTTGGGACTGG + Intergenic
1155571300 18:27196901-27196923 AAAGGAGGGAGTGTGGTTCCAGG - Intergenic
1155671377 18:28376151-28376173 ATGGCAGGGAATGTGGGTCCAGG + Intergenic
1155741607 18:29296556-29296578 AAAGCAGAGGTTCTTTGTCCTGG + Intergenic
1156303490 18:35855840-35855862 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1156532749 18:37834127-37834149 AAAGCAGGGATTCTTGCTTTGGG + Intergenic
1157605245 18:48922360-48922382 GCAGCAGGCTTTCTGGGTCCTGG - Intronic
1157902782 18:51536233-51536255 AAAGCAGGAATTATGGTGCCAGG + Intergenic
1159559470 18:69978041-69978063 AACTCAGGGATTCTGTCTCCTGG - Intergenic
1160147365 18:76376046-76376068 AGAACACGGATGCTGGGTCCAGG + Intronic
1161840156 19:6675155-6675177 AAAGCATGGATTCTTGGCTCAGG + Intergenic
1161907278 19:7166239-7166261 AAAGATGGCATACTGGGTCCAGG + Exonic
1162424313 19:10584852-10584874 ACAGCAGGGATTCTGGACCCAGG - Intronic
1163688429 19:18725360-18725382 AGAGCAAGGATTCTGGGAGCTGG - Intronic
1164532882 19:29061476-29061498 TAAGCTGGGATTCTGAATCCAGG - Intergenic
1165640446 19:37380799-37380821 AAAGAAGGAATTCTTGTTCCCGG + Intronic
1165781651 19:38438117-38438139 AGAGGAGGGAGTCTGGGTGCTGG - Intronic
1166908744 19:46135436-46135458 AGAGCAGGGGTTCTGGCTCTCGG - Intergenic
1167034035 19:46982778-46982800 AATGCTGGGATTCTGGGTGTGGG - Intronic
1167265203 19:48479612-48479634 AATGCAGGGATTCAGGGTCAAGG + Intronic
1167337705 19:48896775-48896797 AAGGCAGGACTCCTGGGTCCTGG - Intronic
1167749776 19:51372543-51372565 AGCTCAGGGCTTCTGGGTCCTGG + Exonic
1168666053 19:58205768-58205790 AAGGCAGGGGCTCTGGGTCCTGG - Intronic
924971764 2:134454-134476 AAAATAGGGTTTCTGGGTACTGG + Intergenic
925128964 2:1481108-1481130 GAAGCAGGGCTTATGGATCCAGG - Intronic
925490155 2:4382528-4382550 AAAAAAAGGATTCTGGGTTCTGG + Intergenic
925502344 2:4519351-4519373 GAAGCAGAGATTCTGGGACAAGG - Intergenic
925854877 2:8119588-8119610 AAAGCAGGGATTCAGGAACAAGG - Intergenic
926026262 2:9547708-9547730 AAATCAGGGATTCTGGGCTTTGG + Intronic
926810784 2:16753604-16753626 AACTCAGGGATTCTGTCTCCCGG - Intergenic
928251327 2:29683740-29683762 AAAGCAGGCTTACTGGGCCCAGG - Intronic
930536974 2:52655189-52655211 AACTCAGGGATTCTGTCTCCTGG - Intergenic
930734369 2:54760715-54760737 AAAGCAGTGATTCTCTGTCAAGG - Intronic
932079014 2:68694474-68694496 AAAGCAGGATTGCTGGATCCTGG - Intronic
932143896 2:69302309-69302331 GAAGCAGGGAGTCTGGGGGCTGG - Intergenic
932366668 2:71157389-71157411 ACAGCAGGGATGCTGGGGGCTGG + Intergenic
932859978 2:75280701-75280723 AATGCAGGGAATCTGGGTGAAGG + Intergenic
934499856 2:94849550-94849572 AAAGCAAGGATTCTTGGGACTGG - Intergenic
935183670 2:100712894-100712916 AACTCAGGGATTCTGTCTCCTGG + Intergenic
936676996 2:114727193-114727215 TAAGCAGGAATTCTGGGAGCAGG + Intronic
937679152 2:124625614-124625636 AGAGCAGCGATTCTAGGCCCTGG - Intronic
937721379 2:125100580-125100602 AAAGAAAGGATACTGGGTCTGGG - Intergenic
937852939 2:126651618-126651640 AACTCAGGGATTCTGTCTCCCGG - Intergenic
938689611 2:133775561-133775583 TAAGCAGGTCTTCTGGGTCCAGG - Intergenic
938981423 2:136530790-136530812 AGAGCAGTGATCCTGGGTCTTGG + Intergenic
939547326 2:143569520-143569542 AAAGCAGGGAAACTGGTTCTGGG + Intronic
941701128 2:168605645-168605667 AAGGCAGGGAAGCAGGGTCCTGG - Intronic
943509099 2:188802363-188802385 AACTCAGGGATTCTGTCTCCTGG + Intergenic
944215454 2:197250271-197250293 AAAGCAGGAAAGCTGGGGCCAGG + Intronic
944770962 2:202913323-202913345 AACCCAGGAATTCTGGTTCCAGG - Intronic
945138855 2:206661818-206661840 AATGCAGGGATTAGGGGTGCTGG - Intronic
945453042 2:210015694-210015716 AAATCAGGAAATCTAGGTCCAGG - Intronic
945969433 2:216221495-216221517 AAAGCATGGCTTCTGGGGACAGG - Intergenic
946449478 2:219767529-219767551 AAAGAAGGGATTTTGCCTCCAGG - Intergenic
947408903 2:229813030-229813052 AAAGCAGGGTTTATGGGCCGGGG - Intronic
947542341 2:230987663-230987685 AAAGCTGTGATACTGTGTCCTGG + Intergenic
948050954 2:234978941-234978963 ACAGCAGGATTTCTGGGTGCCGG + Exonic
1170359794 20:15533717-15533739 ATAGCAGGAATTCTGGGGCTGGG - Intronic
1171448799 20:25222309-25222331 AAAGCCGGGAAGCTGGGTCAAGG + Intronic
1172782585 20:37446036-37446058 GCAGCAGAGATTCTGAGTCCTGG - Intergenic
1173643155 20:44617411-44617433 AAAGCATGGAGACTGGGGCCTGG + Intronic
1173820236 20:46014658-46014680 GAGGCAGGAAATCTGGGTCCTGG - Intronic
1174172539 20:48626410-48626432 AAAGCTGGGATTCTGAACCCAGG - Intronic
1174265900 20:49331933-49331955 AAAGCAGGGACTGTGGGTCAAGG - Intergenic
1174579332 20:51560335-51560357 AAGGCAGGGAGTCTGGGTTTGGG + Intronic
1174892613 20:54412875-54412897 AAAGGAGGAGTTCTGGGTCTGGG + Intergenic
1175307025 20:57983068-57983090 AAAGCAGGGTGTCTGGGTGGTGG - Intergenic
1175458544 20:59133594-59133616 AAAGCATGGATTTTGGGTTATGG + Intergenic
1175501063 20:59451209-59451231 AAAGCAGGGATTTTTGAGCCAGG - Intergenic
1176385454 21:6136774-6136796 GAAGCGGGGATTCTGGGCTCTGG - Intergenic
1176855934 21:13971515-13971537 AAAGCAAGGATTCTTGGGACTGG - Intergenic
1177003014 21:15636468-15636490 AACTCAGGGATTCTGTCTCCCGG - Intergenic
1177363343 21:20102924-20102946 AACTCAGGGATTCTGTCTCCGGG + Intergenic
1178061124 21:28854077-28854099 AACTCAGGGATTCTGTCTCCTGG - Intergenic
1179397626 21:41056126-41056148 GAAGCAGGGAGGCTGGGTACTGG + Intergenic
1179738019 21:43401478-43401500 GAAGCGGGGATTCTGGGCTCTGG + Intergenic
1181116813 22:20636589-20636611 AAGGAAGGGGTGCTGGGTCCCGG + Intergenic
1181182564 22:21078221-21078243 CACCCAGGGATTCTGGGTGCCGG - Intergenic
1181235909 22:21447522-21447544 CAAGAAGGGCTTCTGGGGCCTGG - Exonic
1181972095 22:26698627-26698649 AAAGCAGGGACTCTGAGAGCAGG + Intergenic
1184303293 22:43576801-43576823 AAAACAGGGATCCTGGGAGCAGG - Intronic
1184464673 22:44661734-44661756 AAAGCAAGGATCCTGGCTCTCGG - Intergenic
1185296248 22:50056759-50056781 AAATCAGGGACTCTGGGGGCAGG - Intronic
950490764 3:13303586-13303608 AATGCAGGCCTTCTGGCTCCAGG + Intergenic
951647470 3:24908869-24908891 AAAGCAGAGAATGTGGGTCAAGG - Intergenic
952398713 3:32944001-32944023 ATAGCAGGGATTGGGGGTGCTGG - Intergenic
952633734 3:35502045-35502067 AAATCAGGGATTCTGGGCATAGG - Intergenic
952777162 3:37057629-37057651 AATGCTGGGATTATGGGTGCGGG + Intronic
953671454 3:44965634-44965656 AAAGCATGGACTGTGGGTCAGGG - Intronic
953899259 3:46830099-46830121 ACAGCAGGGAGACTGGGGCCTGG - Intronic
954053685 3:48004483-48004505 AACTCAGGGATTCTGTTTCCTGG + Intronic
954208352 3:49077617-49077639 AAAGCATGGACTCTGGAGCCAGG + Intronic
955410386 3:58651810-58651832 AAAGCAGCGATCCTGGGTGGGGG + Intronic
956509260 3:69977432-69977454 AACTCAGGGATTCTATGTCCTGG + Intergenic
957247915 3:77736261-77736283 AACTCAGGGATTCTGTCTCCAGG - Intergenic
957754229 3:84466441-84466463 AACTCAGGGATTCTGTCTCCTGG + Intergenic
959186890 3:103056302-103056324 GAAGCAGGGTTACTGGGACCAGG - Intergenic
960068420 3:113400620-113400642 AGAAGAGGCATTCTGGGTCCTGG + Exonic
960087286 3:113604994-113605016 AAAGCTGGGACTCTGGGGCTGGG - Intronic
961125650 3:124415319-124415341 AAAGCAGTGGTTCTTGGCCCTGG - Intronic
961170009 3:124790633-124790655 CAAGCATGGGTTCTGGGTCTGGG - Intronic
961475296 3:127142169-127142191 AAAGCCGGGATGCTGGGCACGGG + Intergenic
961478933 3:127167089-127167111 AGAGCGGGGATGCTGGGTACAGG + Intergenic
961533602 3:127555641-127555663 AATCCAGGCATTCTGGCTCCAGG - Intergenic
963803766 3:149702353-149702375 AATGCAGAGATTCTGGGTTTTGG + Intronic
964475571 3:157095117-157095139 AAAGCAGGGATTATAGGTTGAGG + Intergenic
964617566 3:158684662-158684684 AAACAAGGTATGCTGGGTCCGGG + Exonic
966458088 3:180141130-180141152 AAAGGAGGTTTTCTGGGTCTTGG - Intergenic
966520768 3:180871100-180871122 AAATCAGGAATTCAGGGTCCTGG + Intronic
966659009 3:182393250-182393272 CAAGCAGGGTTACTGGGTACTGG + Intergenic
968064652 3:195751938-195751960 AGAGCAGGGATTCTGATTCTGGG + Intronic
968131295 3:196194305-196194327 TAAGCAGGGACTCTGGGGCCCGG - Intergenic
968601018 4:1509367-1509389 AAAGCAGGGAAACTGAGGCCAGG + Intergenic
968921501 4:3524460-3524482 AAGGCAGGGGCTCTGGGTGCAGG - Intronic
969048841 4:4358251-4358273 AGAGCAAGGATTCTGGAGCCAGG + Intronic
969700062 4:8762993-8763015 ACAGCAGAGGCTCTGGGTCCTGG + Intergenic
970129951 4:12857581-12857603 AAAGAAGGCAATCTGGGGCCGGG + Intergenic
970480041 4:16463514-16463536 AAATCAGGAATTCTGGGTGTGGG - Intergenic
971164922 4:24172954-24172976 AACCCAGGGATTCTATGTCCTGG + Intergenic
971226764 4:24761268-24761290 AAATCAGAGACTCTGGGACCAGG - Intergenic
971582373 4:28358287-28358309 AAAGCAGTGATTCTCAGTCAAGG - Intergenic
972192530 4:36612348-36612370 AACTCAGGGATTCTGTCTCCTGG + Intergenic
973215325 4:47662108-47662130 AGAGAAGGGAATCTGTGTCCTGG - Intronic
973691143 4:53433718-53433740 AAAGCAGGGATCCTGGTTTGTGG - Intronic
975982999 4:80180196-80180218 AACTCAGGGATTCTGTCTCCTGG - Intergenic
976194083 4:82516391-82516413 AAACCAGAGAATCTGGATCCAGG - Intronic
976284648 4:83359836-83359858 AAAGCAGAGAGTCTGGGCCAAGG - Intergenic
977430380 4:96925306-96925328 AACTCAGGGATTCTGTCTCCCGG + Intergenic
977586579 4:98781166-98781188 AAAGAAGGAATTCTGTCTCCAGG + Intergenic
978772347 4:112469220-112469242 AACTCAGGGATTCTGTCTCCTGG + Intergenic
979360021 4:119750935-119750957 AAACCTGGGATTCTTGGCCCAGG - Intergenic
980468835 4:133222919-133222941 CGAGGAGGGATTCTGGGTCTTGG + Intergenic
981552363 4:145954947-145954969 AAAGGAGGGAATCTGTGCCCAGG + Intergenic
981733555 4:147925243-147925265 AAAGCAGGCATTCTTCCTCCTGG + Intronic
981834475 4:149039543-149039565 AACTCAGGGATTCTGTCTCCTGG + Intergenic
982153586 4:152492734-152492756 AAAGCACGGCCTCTTGGTCCAGG - Intronic
982227480 4:153179592-153179614 GGAGCAGGGATTCTGGGTTCTGG + Intronic
983030609 4:162797040-162797062 AAAACAGGAATTCTGAGTTCAGG - Intergenic
983581858 4:169317335-169317357 AACTCAGGGATTCTGTCTCCCGG + Intergenic
985771206 5:1812621-1812643 AAATGACTGATTCTGGGTCCAGG - Intronic
985807662 5:2059082-2059104 AAAGCAGAGACTCTGGGTCCAGG - Intergenic
985809004 5:2069423-2069445 AAAGTAGAAACTCTGGGTCCAGG + Intergenic
986742605 5:10717177-10717199 AACTCAGGGATTCTGTCTCCGGG + Intronic
987885243 5:23804984-23805006 AACTCAGGGATTCTGTCTCCCGG + Intergenic
988164388 5:27565512-27565534 AAGCCAGGGAGTCTGGCTCCAGG - Intergenic
989045693 5:37271164-37271186 AACTCAGGGATTCTGTCTCCTGG - Intergenic
989263621 5:39447305-39447327 AAAACAGGGATTCTTGTTTCAGG + Intronic
989455284 5:41637043-41637065 AAAGCAGGCATCCTAGGTCATGG - Intergenic
990469618 5:56102965-56102987 AAAGCAGAGTTTCTCAGTCCTGG + Intronic
991033159 5:62102994-62103016 AACTCAGGGATTCTGTCTCCTGG + Intergenic
992035270 5:72767755-72767777 AAAGAAGGGATTCTGCGTGTAGG + Intergenic
992086989 5:73286483-73286505 ACAGCAGAGCTTCTGGTTCCTGG + Intergenic
992612811 5:78522049-78522071 AAAGCAAATATTCTGGGTTCTGG - Intronic
992643681 5:78792683-78792705 AGTGCACGGATTCTGGGTACAGG + Intronic
993698276 5:91087862-91087884 AAAGCATGGACTCTGGAACCAGG - Intronic
994291764 5:98034908-98034930 AACTCAGGGATTCTGTCTCCTGG - Intergenic
994836759 5:104865221-104865243 AACTCAGGGATTCTGTCTCCTGG + Intergenic
994984795 5:106918650-106918672 AACTCAGGGATTCTGTCTCCTGG - Intergenic
995279457 5:110316832-110316854 AACTCAGGGATTCTGTCTCCTGG - Intronic
995832795 5:116372620-116372642 TAAGTAGGGATTCTGGTTCTGGG - Intronic
997695804 5:135859748-135859770 GGAGCAGGGTTTGTGGGTCCAGG + Intronic
998678403 5:144436452-144436474 AGAGAAAGGATTCTGGGTTCAGG + Intronic
998975831 5:147645668-147645690 AAAGCAGGGTTTCTCAGTCTCGG + Intronic
999148357 5:149410486-149410508 CTAGAAGGGGTTCTGGGTCCTGG + Intergenic
1000730392 5:164828028-164828050 AAATCAGGGATTCTGTCTCCTGG + Intergenic
1001360189 5:171076285-171076307 AAAACTGGGATTTTGGGTTCTGG + Intronic
1001369880 5:171188447-171188469 GAATCAGGCATACTGGGTCCTGG + Intronic
1004128348 6:12895877-12895899 AAAGCAGAGTTTCTCAGTCCTGG - Intronic
1004442112 6:15663322-15663344 ATTGCATGGATTCTAGGTCCAGG + Intergenic
1004473963 6:15953731-15953753 AAAGCAGTGATTCTCAGCCCTGG - Intergenic
1004813226 6:19283279-19283301 AAAGCAGAGATTCTGGGAGTAGG + Intergenic
1004824689 6:19406155-19406177 AACTCAGGGATTCTGTCTCCCGG - Intergenic
1005298389 6:24448282-24448304 AAAGGACTGACTCTGGGTCCAGG + Intronic
1005434446 6:25793258-25793280 AAAGCAGGGATTCTTAATCTAGG - Intronic
1005434482 6:25793691-25793713 ATAGCAGGGATTCTTAATCCAGG + Intronic
1006300481 6:33191423-33191445 AAGCCAGGAATTCTGGGTCCTGG + Intronic
1006371903 6:33650039-33650061 AAAGTAAGGATTGTGTGTCCCGG - Intronic
1006381242 6:33698606-33698628 AAAGCAGGGTTTCTTGGCCTTGG + Intronic
1006548481 6:34800346-34800368 ACAGCAGGGATTGTGTGTCTTGG + Intronic
1008182391 6:48347700-48347722 AAAGGAAGGATTCTTGGTCTGGG - Intergenic
1009810177 6:68652242-68652264 AAAGCAGAGACACTGAGTCCTGG - Intronic
1010323175 6:74537462-74537484 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1011649153 6:89489953-89489975 TACTCAGGGATTCTGTGTCCTGG + Intronic
1013812512 6:114060884-114060906 AAAGCATGGATTCTGAGTATGGG + Intronic
1014445395 6:121521387-121521409 AAAGAAGGAATTCTGCCTCCAGG - Intergenic
1014534588 6:122599566-122599588 AATGAAGGGATTCTGTCTCCTGG - Intronic
1015385038 6:132612548-132612570 AAACCAGAGATTCTGAGTCTGGG + Intergenic
1015483205 6:133739092-133739114 AACCCAGGCATTCTGGTTCCAGG - Intergenic
1015581247 6:134727835-134727857 AAAGCAGGGATGCTGGGGCTAGG - Intergenic
1016028964 6:139317973-139317995 AAAGAAAGGATTATGGGGCCGGG + Intergenic
1017359761 6:153554032-153554054 AAAGCAAGGATTCCAGGCCCAGG + Intergenic
1017541401 6:155406726-155406748 AAAGCAGGGATTTCGGGTGGTGG - Intronic
1017818178 6:158029936-158029958 AACCCAGGCTTTCTGGGTCCAGG + Intronic
1018107711 6:160504737-160504759 AACTCAGGGATTCTGTCTCCTGG - Intergenic
1018389148 6:163329641-163329663 CAAGGAGGGATTCTGGCTGCAGG - Intergenic
1018599480 6:165524598-165524620 AACCCAGGGATTCTGTCTCCTGG + Intronic
1019291000 7:250243-250265 AAATCATGGATTCGGGGGCCGGG - Intronic
1020056806 7:5123325-5123347 ACAGCAGGGAATCTGAGGCCAGG - Intergenic
1020282546 7:6656854-6656876 AAGGGAGGCATTTTGGGTCCTGG - Intergenic
1020396326 7:7722602-7722624 AATTCAGGGATTCTGACTCCTGG + Intronic
1021585585 7:22203952-22203974 AAAGCAGTGATTCGGGTTACTGG - Intronic
1023077621 7:36499660-36499682 CCAGCAGGGCTTCTGGGTCAGGG - Intergenic
1025130008 7:56370222-56370244 AGAGCTGGGACTCTGGGTGCAGG - Intergenic
1025260338 7:57414007-57414029 GAAGCAGGGATGGAGGGTCCTGG + Intergenic
1026959752 7:74400709-74400731 AAACCAGGGTTTCTGGGACAGGG - Intronic
1027775094 7:82455083-82455105 GAATCAGGGATTCAGGGTTCGGG - Intergenic
1029120085 7:98261927-98261949 AAAGCATGGCTTCAGGGGCCAGG - Intronic
1029469945 7:100748037-100748059 GGAGTAGGGATTCTGGGTCCTGG + Intronic
1031293033 7:119963831-119963853 AAAGCAGAGATTAAGGGTCAGGG - Intergenic
1031585844 7:123532132-123532154 AACCCAGGAATTCTGGTTCCAGG + Intronic
1032399361 7:131613015-131613037 AAAGCAGGGTTTCAGGGACTGGG - Intergenic
1033913576 7:146295357-146295379 AAAGCATGTATTCAGGGTACAGG + Intronic
1034257331 7:149731813-149731835 CAAGCTGGGGCTCTGGGTCCTGG - Intronic
1035302148 7:157904528-157904550 AAAGCACAGAATCCGGGTCCCGG + Intronic
1036293666 8:7517822-7517844 AGAGCAGGGATGCTGAGGCCTGG + Intergenic
1036328895 8:7803173-7803195 AGAGCAGGGATGCTGAGGCCTGG - Intergenic
1036946440 8:13099370-13099392 AAAGAAGGGATTCTGGGGTTGGG - Exonic
1037031211 8:14107936-14107958 AAAACAGGGATCCTGAGGCCGGG - Intronic
1038299259 8:26327017-26327039 AAAGAAGGGAAACTGGTTCCAGG + Intronic
1038458407 8:27694272-27694294 TAAGCAGTGACTCTGAGTCCAGG - Intergenic
1039476008 8:37839762-37839784 AAGGCAGGGATGGTGGGTCGTGG + Intronic
1039576594 8:38628646-38628668 ATAGCAGGGATTCTGGAGGCAGG - Intergenic
1043591868 8:81842280-81842302 ACAGCAGGGATCTTGGGCCCGGG - Exonic
1045000845 8:97876744-97876766 TGAGCGGGGATTCTGGGTGCTGG - Intronic
1046118686 8:109817569-109817591 AGAGCAGGGATTCTAGAGCCAGG + Intergenic
1049547216 8:143238597-143238619 AAAACAGAGATTCTGGACCCCGG + Intergenic
1049905360 9:211805-211827 AAAGCAGGAAATCTGGGTTCTGG - Intergenic
1050260750 9:3838480-3838502 AATCCAGGGATTCTGCTTCCTGG + Intronic
1052154035 9:25160130-25160152 AAAGCAGGTATTCTAAGTCATGG - Intergenic
1052368248 9:27637912-27637934 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1053414120 9:37935728-37935750 CAGGGAGGGATTCTGGCTCCAGG + Intronic
1054357762 9:64079484-64079506 AAAGCAAGGATTCTTGGGACTGG + Intergenic
1056413192 9:86352826-86352848 ATAACAGGAATTCTAGGTCCAGG + Exonic
1056695416 9:88846298-88846320 AAAGAATGGATTCAGGGGCCAGG + Intergenic
1056767462 9:89453724-89453746 AAAGCAGGCATTGTGGTTCCCGG - Intronic
1057316194 9:93970199-93970221 AATTCAGGGATTCTGTCTCCCGG + Intergenic
1059066534 9:111091590-111091612 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1059602189 9:115791011-115791033 AAAGCAGGGGATCTGGCTCCAGG + Intergenic
1059760880 9:117336403-117336425 AAGTCAGGGCTTCTGGGGCCTGG + Intronic
1059961915 9:119573975-119573997 AAAGCTGGGAAGCTGGGGCCTGG - Intergenic
1060315296 9:122504247-122504269 AAAGCAGTGTTTCTGGAGCCAGG - Intergenic
1060548876 9:124475991-124476013 AAACCCGGGCTTCTGGGGCCTGG + Intronic
1060872712 9:127055682-127055704 AGAGCATGGATTCTGGAGCCAGG - Intronic
1060881952 9:127123533-127123555 AAAGCAGAGGTTCTGGGAGCAGG - Intronic
1061429752 9:130523669-130523691 ACAGCAGGACTCCTGGGTCCTGG - Intergenic
1061599834 9:131660770-131660792 TGAGGAGGGATTCTGGGCCCTGG + Intronic
1062010821 9:134265766-134265788 CCACCAGGGATTCTGGGCCCTGG - Intergenic
1062136925 9:134934018-134934040 AAGGCAGGGAGCATGGGTCCAGG + Intergenic
1062262401 9:135669578-135669600 GCTGCAGGGATTCTGGGCCCTGG - Intergenic
1203786147 EBV:128909-128931 AATGCAGGATTTCTGCGTCCTGG + Intergenic
1203560699 Un_KI270744v1:54038-54060 AAAGCAAGGATTCTTGGGACTGG - Intergenic
1186283972 X:8024360-8024382 AAAGCAGGAATTTTAGTTCCAGG - Intergenic
1186868985 X:13750739-13750761 AAAGCTGGGATTATAGGTGCGGG + Intronic
1186874241 X:13801327-13801349 AGAACAAGGATTCTGGGGCCTGG + Intronic
1187257830 X:17657586-17657608 AAGGCAGGGATGCTGAGTGCTGG + Intronic
1187863413 X:23702667-23702689 AAACCAGGCAATGTGGGTCCCGG - Exonic
1188172872 X:26949861-26949883 CAAGCAGGGCTCCTGTGTCCTGG + Intergenic
1188981865 X:36733917-36733939 AAAGCATGGATGCAGGGTACAGG - Intergenic
1189249947 X:39593047-39593069 AAGGCATGGATTCTTGGACCAGG + Intergenic
1190277133 X:48906079-48906101 AGAGCCTGGATTCTGGGGCCAGG - Intronic
1191758988 X:64626961-64626983 AACTCAGGGATTCTGTCTCCTGG + Intergenic
1193167703 X:78301099-78301121 AAAGCAGGGGTTCCTGGGCCTGG + Intronic
1194849546 X:98854404-98854426 AAATCAGTGATTCTGTCTCCTGG - Intergenic
1195749235 X:108147613-108147635 AACTCAGGGATTCTAGCTCCAGG - Intronic
1195782755 X:108482800-108482822 AACTCAGGGATTCTGCCTCCTGG - Intronic
1196747086 X:119080734-119080756 AATGCTGGGTTTCTGGGTGCTGG + Exonic
1197037286 X:121889816-121889838 AAGGCTGGGATTCTGGGTTTTGG + Intergenic
1197733060 X:129828118-129828140 AAAGCAGGAATTCTTGGTTGGGG + Intronic
1197737716 X:129864145-129864167 AAAGAATGGATTGTGGGTCTGGG - Intergenic
1198512918 X:137372250-137372272 AAACCAGGTTTTCTGGCTCCAGG - Intergenic
1198554759 X:137781319-137781341 AAAGCAGGGAGTCAGGATGCTGG + Intergenic
1198691826 X:139292964-139292986 AAGGCAGGTATCCTAGGTCCAGG + Intergenic
1198933625 X:141884872-141884894 AACTCAGGGATTCTGACTCCTGG + Intronic
1199627468 X:149753527-149753549 AACTCAGGGATTCTGTCTCCCGG - Intergenic
1199687289 X:150275573-150275595 GAGGCAGGAGTTCTGGGTCCAGG - Intergenic
1199694435 X:150333911-150333933 GAAGCAGAGATTCTGGGTATAGG - Intergenic
1199944772 X:152656412-152656434 AAAGAAGGGATCCTGGGTCGGGG - Exonic
1200955204 Y:8937643-8937665 ACAGAAGGCTTTCTGGGTCCTGG - Intergenic
1201861933 Y:18608074-18608096 AAAGCTGGGATTTTAGGTGCTGG - Intergenic
1201871390 Y:18712306-18712328 AAAGCTGGGATTTTAGGTGCTGG + Intergenic