ID: 1119452406

View in Genome Browser
Species Human (GRCh38)
Location 14:74723162-74723184
Sequence CTGTCATTGCAAAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119452406 Original CRISPR CTGTCATTGCAAAAGTGTCC TGG Intronic
901063055 1:6482259-6482281 CTGTCCTTGCGAATGTGACCAGG - Intronic
901093908 1:6663180-6663202 CTGTAATAGCAAAAATGGCCAGG + Intronic
902363611 1:15956435-15956457 CTGTCATTTCATAAGGGTCTAGG - Intronic
904061772 1:27716739-27716761 CAGTCATTTCAAAAGTTTCATGG + Intergenic
907727309 1:57031829-57031851 CTGGCATTTCAAATGTCTCCTGG + Intronic
908411630 1:63871641-63871663 CTGTCAAGGCAAATGTCTCCTGG - Intronic
909427818 1:75547524-75547546 CAGTCAAAGCAAAAGTGTCCTGG + Intronic
919040249 1:192378131-192378153 TTTTCATAGCAAATGTGTCCTGG - Intergenic
920194230 1:204215800-204215822 CTGTCTTTACAACACTGTCCCGG - Intergenic
1065244995 10:23747887-23747909 CTCTCATTGCAAAACAGCCCAGG - Intronic
1067001046 10:42613934-42613956 CTGTCACTGCAAGATGGTCCAGG - Intronic
1072573974 10:96683005-96683027 CCATCATTGCACAAGTCTCCAGG + Intronic
1074622517 10:115140021-115140043 CTGTCATTGCCACAGGATCCTGG + Intronic
1075003422 10:118814113-118814135 CTGACATTGGAGAAATGTCCTGG - Intergenic
1076148032 10:128140715-128140737 CTGTCCTTGCAAATCTCTCCTGG + Intergenic
1080925840 11:36755068-36755090 CTGTCTTGGCAAAGTTGTCCAGG - Intergenic
1081349721 11:42035823-42035845 TTTTCATTGCAACAGTCTCCTGG - Intergenic
1081589765 11:44413436-44413458 CTTTCATTGCTAAAGTGGTCTGG - Intergenic
1086974905 11:93120521-93120543 CTTCCATGGCAAGAGTGTCCTGG - Intergenic
1088631426 11:111777301-111777323 CTATAATTGCAAAAATTTCCTGG - Intergenic
1090516530 11:127434121-127434143 CTTTCACTCTAAAAGTGTCCAGG + Intergenic
1090632371 11:128661098-128661120 CTGCTATTGCAAAAGTGGCTTGG - Intergenic
1090660960 11:128881138-128881160 CTGTCTTTGCCAGAGTGTCAGGG + Intergenic
1091590339 12:1839002-1839024 CTGACATTGCCAAATTGCCCGGG - Intronic
1095676233 12:44921960-44921982 CAGTCTTTGCAAAAATGTCGGGG + Intergenic
1095791317 12:46170461-46170483 CTGTCTTTGGAAAAGATTCCTGG + Intergenic
1095931244 12:47627648-47627670 CTATCAATGAAAAAATGTCCAGG + Intergenic
1096817744 12:54212314-54212336 CTGCCTTTGCAAAAGGATCCAGG + Intergenic
1097704959 12:62858585-62858607 CTGCCATTCCTATAGTGTCCCGG + Intronic
1097735081 12:63173576-63173598 CTTTCTTTGCATAAGTGACCGGG + Intergenic
1101773691 12:107775085-107775107 CTGTCTTTGCAGAAGTTTCTGGG - Exonic
1101796765 12:107982273-107982295 CTGTCAGTTTAAGAGTGTCCAGG + Intergenic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1104332019 12:127855809-127855831 CTGACATAGCAGAAGGGTCCTGG + Intergenic
1105339608 13:19508143-19508165 TTTTCCTTTCAAAAGTGTCCTGG - Intronic
1106465717 13:30012940-30012962 CTGTGAGTGCTAATGTGTCCTGG + Intergenic
1107951820 13:45469370-45469392 CTGTCATTTCAAAGGGATCCAGG - Intronic
1108296774 13:49028540-49028562 CTTTGATTTCAAGAGTGTCCTGG - Intronic
1108800838 13:54092760-54092782 CAGTAATTGGAAAAGTGGCCAGG - Intergenic
1108953395 13:56119271-56119293 AGGTCATTGCAAAACAGTCCTGG + Intergenic
1112227556 13:97554943-97554965 CTATCATTGCAAGGGTGTACTGG + Intergenic
1113898945 13:113785244-113785266 CTGTCACTGGCAAAGTGCCCAGG + Intronic
1116942649 14:50805771-50805793 CTTTCATTGCACAAGTCTCTGGG + Intronic
1118799022 14:69172200-69172222 ATGTGACTGCAAAACTGTCCTGG + Intergenic
1119005501 14:70923844-70923866 CAGTCATTTCACATGTGTCCAGG + Intronic
1119452406 14:74723162-74723184 CTGTCATTGCAAAAGTGTCCTGG + Intronic
1120396950 14:83980114-83980136 TTGTGATTTCAAGAGTGTCCAGG - Intergenic
1120613062 14:86666344-86666366 CTGTTATTTCAAAAGTTTCCAGG - Intergenic
1121169300 14:91839853-91839875 GTGACATTTCAAAAGTGTCATGG + Intronic
1122837169 14:104436022-104436044 CTGACATTCCAGAGGTGTCCAGG + Intergenic
1124513727 15:30348922-30348944 CTGTCCTTGCGACAGTGTCTTGG + Intergenic
1124729194 15:32181843-32181865 CTGTCCTTGCGACAGTGTCTTGG - Intergenic
1125573084 15:40735983-40736005 CTGTCATTCCAAAAGCTGCCAGG + Exonic
1126939315 15:53749053-53749075 ATGTAAATGCAAGAGTGTCCAGG + Intronic
1127737688 15:61859629-61859651 GTGTCATGGGAAAAGTGTCAGGG - Intronic
1128385409 15:67144726-67144748 CTGTCTTTGCAAAAATGTTGAGG + Intronic
1129917248 15:79284435-79284457 CTTTCCTTGCAAAAGTGTCAGGG + Intergenic
1129998771 15:80029349-80029371 CTGCCATTTCTCAAGTGTCCAGG + Intergenic
1131287529 15:91074071-91074093 CTGTCATTGGAAATGAATCCTGG + Intergenic
1134688545 16:16175546-16175568 CTGTCAAAGCATAAGTGGCCAGG + Intronic
1135322539 16:21506973-21506995 CTGTCATTACAAATGACTCCTGG - Intergenic
1136334018 16:29600111-29600133 CTGTCATTACAAATGACTCCTGG - Intergenic
1137391055 16:48081900-48081922 CTGACATTGCACAACTGTCATGG + Intergenic
1138009200 16:53362113-53362135 CTGTCATTCCAGGAGAGTCCAGG - Intergenic
1140094048 16:71860131-71860153 CTGCCATGGCAGAAGGGTCCTGG + Exonic
1140474156 16:75230257-75230279 TTGTCATTTCAAAAATGTTCAGG - Intronic
1143949323 17:10620198-10620220 CTGTCATGTCAAAAGTGGCCTGG - Intergenic
1148644748 17:49213256-49213278 CTGTCCTTGCAAAAATATGCAGG + Intronic
1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG + Intronic
1153702331 18:7708531-7708553 CTCTCATTGTAAAAATGTTCAGG - Intronic
1156382102 18:36572667-36572689 CTCCCATTGTAATAGTGTCCTGG + Intronic
1156641302 18:39103177-39103199 CCCTCATTGCAAAAGTGTACTGG - Intergenic
1159693555 18:71523213-71523235 CTGTCACAGGAAAAGTTTCCAGG - Intergenic
1160510202 18:79449094-79449116 CTGTTAAACCAAAAGTGTCCTGG - Intronic
1165895164 19:39136918-39136940 CTGCCATTGCAGAGGTCTCCCGG + Intronic
1168197177 19:54783570-54783592 CTGTTATTCCCAAAGAGTCCTGG + Intronic
926354933 2:12033193-12033215 GTGGCATTGTAAAAGTGTCCTGG + Intergenic
926457861 2:13090909-13090931 CTGTCACTACAAAATTTTCCAGG + Intergenic
926716856 2:15931387-15931409 CTGTCACTGTAAAAGTGACATGG + Intergenic
928181310 2:29070911-29070933 CAGTCATAGCCAAAGTGTCTGGG - Exonic
929720003 2:44358587-44358609 CTTTCCTCTCAAAAGTGTCCTGG - Intronic
929830791 2:45344705-45344727 CTGTCATTGCAAAGGTGCTGGGG - Intergenic
931089624 2:58871487-58871509 CTGACATTGCATATGTATCCTGG + Intergenic
931918971 2:66991790-66991812 CTGTCAATGCAACACTTTCCAGG - Intergenic
932865687 2:75339437-75339459 GTGTCAATGGAAAAGTGACCTGG - Intergenic
934708724 2:96502027-96502049 CTGTCACCGCAAACGTGTCCTGG - Intronic
938782846 2:134600990-134601012 CTATGAAGGCAAAAGTGTCCAGG - Intronic
940297257 2:152140459-152140481 TTGTCATTGCAAAAGTTAGCAGG - Intronic
944930008 2:204507601-204507623 CTGTCAGTGCTGGAGTGTCCAGG - Intergenic
944989736 2:205221812-205221834 CTGTCTTGGTAAAAGTTTCCAGG + Intronic
945485880 2:210395052-210395074 CAGTCAATGCAAAAGTCTTCAGG + Intergenic
948254839 2:236559121-236559143 CTCTCATGGCAAAAGTTTCCTGG + Intergenic
1169218759 20:3808414-3808436 TTGTCATGGCAAAAGTTACCGGG - Intergenic
1170737087 20:19021844-19021866 CTGTCATTGCCAAAGATGCCAGG + Intergenic
1172329872 20:34068074-34068096 CTGACATTGCAGAAGTCTCTAGG + Intronic
1173015273 20:39219963-39219985 GTCTCATTGCAAAACCGTCCAGG + Intergenic
1173029117 20:39338430-39338452 CTGTCATTGAACTTGTGTCCTGG - Intergenic
1175031181 20:55955795-55955817 CTGACAGTACAAAAATGTCCAGG + Intergenic
1175128807 20:56773900-56773922 CTTTCATGGCAAAAGATTCCAGG + Intergenic
1175544924 20:59771963-59771985 CTCTCATTCCAAAAGCGTCCTGG - Intronic
1175587286 20:60151688-60151710 CTGTCATTTCAAAAGTGGAAGGG - Intergenic
1176734586 21:10533614-10533636 TTTTCCTTTCAAAAGTGTCCTGG + Intronic
1180562321 22:16629088-16629110 TTTTCCTTTCAAAAGTGTCCTGG + Intergenic
1181049503 22:20231878-20231900 CTGTCTTTCCACAGGTGTCCAGG + Intergenic
1182466014 22:30516739-30516761 ATGTGACTGCAAAACTGTCCTGG - Intergenic
1184943854 22:47787188-47787210 CTCACACTGCAAAAGTGGCCTGG + Intergenic
949517590 3:4821328-4821350 CTGTCATTCCACAAGTCTCCAGG - Intronic
949948410 3:9208491-9208513 ATGTGATTGCAACAGAGTCCGGG - Intronic
950893357 3:16425400-16425422 CTGTCATTTCAAAATAGTTCTGG + Intronic
952507456 3:34020242-34020264 CAGTCATTGGAACAGTGTGCTGG - Intergenic
953236015 3:41107892-41107914 CTTACAGTACAAAAGTGTCCAGG - Intergenic
956198905 3:66684657-66684679 CTGTAACTGCACAAATGTCCAGG + Intergenic
959595598 3:108125537-108125559 CTGTCATAGCAAAAATGCCCAGG - Intergenic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
961588459 3:127955951-127955973 CTCTAATTGCAAGAGTGTTCTGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
970605753 4:17680654-17680676 CTCTCAGTGCTAAAGTGGCCTGG + Intronic
972061534 4:34879793-34879815 CTGTTATTTCAAAAGTGCCCTGG - Intergenic
972334078 4:38090868-38090890 CTGTAATTCCAAAATTGTTCTGG - Intronic
972798758 4:42449868-42449890 CTGTCATTGCTAAGGTGTTTTGG + Intronic
973617269 4:52691565-52691587 CTGCCAGTGCAAAACTGTGCGGG + Intergenic
975568246 4:75783773-75783795 CTTTCACTTCAAAAGTGTCCTGG + Intronic
976936861 4:90646855-90646877 CAGACAGAGCAAAAGTGTCCTGG + Intronic
979928310 4:126595877-126595899 CTGTCATTGGAATGATGTCCAGG - Intergenic
981854784 4:149275476-149275498 CAGTCATAGCAAAAGTGAACTGG - Intergenic
983986366 4:174064889-174064911 CTGTCATAGCAAGAGAGGCCTGG + Intergenic
986216517 5:5724504-5724526 GGGTTATTGCAACAGTGTCCAGG + Intergenic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
992219088 5:74554296-74554318 TTGGGATTGCAAATGTGTCCAGG - Intergenic
992655882 5:78909129-78909151 CTGTCACTGCAAAAGGTTTCTGG + Intronic
994384811 5:99118702-99118724 CAGTCAATGCAAAAGTGGACTGG + Intergenic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
999340437 5:150765425-150765447 CTGTCAGTCCAAAAGTATCCAGG - Intergenic
999692303 5:154158686-154158708 CTGTCTTTCCAAAAATGTTCTGG + Intronic
1000309922 5:160032613-160032635 CTGTCATTGCAGCCCTGTCCTGG + Intronic
1000702374 5:164468972-164468994 CAGACATTGCAAATGTGCCCTGG - Intergenic
1003548637 6:7082765-7082787 CTTTCATTGCAAAAGCAGCCAGG + Intergenic
1003560826 6:7178364-7178386 CTGTTGTTCCAAAATTGTCCAGG + Intronic
1004733126 6:18377833-18377855 CTTTCATTGTCAAAGTGTCCTGG + Intergenic
1007297464 6:40836480-40836502 CTGTCTTTGGAACAGAGTCCTGG - Intergenic
1010765644 6:79775306-79775328 CTGGCATTGTACAAGTGGCCAGG - Intergenic
1011813074 6:91155350-91155372 CTGTCACTGCTAAAGTCTGCAGG + Intergenic
1012115217 6:95288268-95288290 CTGTTATTGCATCAGTGTCTAGG - Intergenic
1012239273 6:96853780-96853802 ATCTCATTTCAAAAGTGTACAGG - Intergenic
1013292922 6:108734069-108734091 CTGTGATTGCACAAGTCTCCAGG - Intergenic
1014013867 6:116507253-116507275 CTGTTGTGGCAAATGTGTCCTGG - Intronic
1014207884 6:118676494-118676516 CTGTCATTGCAACAATATGCAGG - Intronic
1016029256 6:139321126-139321148 CTGTCAGTGTAGAAGTGCCCCGG + Intergenic
1020776047 7:12455138-12455160 CTCTCAGTGCAATAGTGACCTGG - Intergenic
1021053647 7:16020201-16020223 CTGTATTTTCGAAAGTGTCCAGG - Intergenic
1021476225 7:21064550-21064572 CTGGAATTTAAAAAGTGTCCTGG + Intergenic
1027336412 7:77155390-77155412 CTGTCACTGCAACAGTGTTAAGG - Intronic
1027782153 7:82533200-82533222 TTATCATTTCAAAAGAGTCCAGG + Intergenic
1029667382 7:102004521-102004543 CTTTCATTCCAAGAGTGTTCTGG + Intronic
1029779379 7:102715711-102715733 CTGTCACTGCAACAGTGTTAAGG + Intergenic
1030254464 7:107492794-107492816 CTTACATTGCAAAAGGGTCTTGG - Intronic
1031160666 7:118163801-118163823 CTGTCACTTCAAAAGTTTCCGGG - Intergenic
1034077493 7:148246393-148246415 CTGTGATTGCAAAAGCAACCGGG + Intronic
1034326516 7:150239282-150239304 CTGTCTGTGCTAAAGTGTGCAGG - Intergenic
1034766697 7:153729973-153729995 CTGTCTGTGCTAAAGTGTGCAGG + Intergenic
1035289551 7:157829053-157829075 CTGGCATCGCAGACGTGTCCTGG - Intronic
1038484560 8:27924553-27924575 GTCACATTGCAAAAGGGTCCTGG + Intronic
1038781174 8:30569356-30569378 CTGTCAAAGCTAAAGTGGCCTGG + Intronic
1041423417 8:57694450-57694472 CTCTAAATTCAAAAGTGTCCTGG - Intergenic
1042762640 8:72287318-72287340 CTGTTATTCTAAAAGTGGCCAGG - Intergenic
1050903275 9:10972293-10972315 CTTCCATTGCAAAAGTGTTGAGG - Intergenic
1053264516 9:36700932-36700954 CTTTTACTCCAAAAGTGTCCTGG + Intergenic
1053319915 9:37087770-37087792 CTGTCATTCCAAAATTCTTCAGG - Intergenic
1056447844 9:86683486-86683508 CTGTCATTACAAAAATTACCTGG + Intergenic
1062106281 9:134756722-134756744 CCGTCAATGCAAAAGAGCCCCGG - Intronic
1188211997 X:27438107-27438129 CTGTCATTTCAAAAGCCTCCTGG + Intergenic
1188525765 X:31086190-31086212 CGATCATTACAAAAGTCTCCTGG - Intergenic
1188837689 X:34978503-34978525 CTGCCAATGCAAATGTGTGCTGG + Intergenic
1189092127 X:38094723-38094745 CTGTTATAGCAAATGTATCCTGG - Intronic
1195489204 X:105448052-105448074 ATGTCATTTCAAATGTCTCCTGG + Intronic
1200311794 X:155085878-155085900 CTGTCATGGCAAAGCAGTCCTGG - Intronic
1201862899 Y:18618705-18618727 CTTTCATTGCAAAACTGTGAGGG - Intergenic
1201870424 Y:18701673-18701695 CTTTCATTGCAAAACTGTGAGGG + Intergenic
1202592620 Y:26503127-26503149 TTTTCCTTTCAAAAGTGTCCTGG + Intergenic