ID: 1119464402

View in Genome Browser
Species Human (GRCh38)
Location 14:74843628-74843650
Sequence TGTACTTATGTCTCTACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119464402 Original CRISPR TGTACTTATGTCTCTACCAA AGG (reversed) Intronic
904687311 1:32270001-32270023 TGAACTTAGGTCTCTAACTATGG + Intronic
905082521 1:35336832-35336854 AGTCCTCATGTCTCTACAAAAGG + Intronic
906300584 1:44678529-44678551 TGTCCTTATTTCTCTCCCAGGGG - Intronic
909803122 1:79839520-79839542 TGTACTTTTGCTTCTACCAGTGG - Intergenic
910491667 1:87779324-87779346 TGGACTTATTTCTCTATCAAAGG - Intergenic
911852562 1:102837648-102837670 TTTACTGATGGCTCTTCCAAAGG + Intergenic
912242809 1:107928275-107928297 TGTACCTATCTTTCTTCCAAAGG - Intronic
918730949 1:187995562-187995584 TGCACTTCTGTCCCTAGCAATGG + Intergenic
921001707 1:211050831-211050853 TTTACTGAGGTCCCTACCAAGGG + Intronic
923789222 1:237097179-237097201 TCTATTTATTTCTCTACCAAAGG - Intronic
923971315 1:239206132-239206154 TGTGCTAATGTCTTTAACAAAGG - Intergenic
924792011 1:247260164-247260186 TGAACTTACATTTCTACCAATGG - Intergenic
1063279682 10:4613401-4613423 TGTACCTAGGTTTCTTCCAAGGG + Intergenic
1072486626 10:95862426-95862448 GTTAATTATCTCTCTACCAAAGG - Intronic
1072818755 10:98535715-98535737 TGAAATTATATCTCTACTAAGGG - Intronic
1075382498 10:122030774-122030796 CCTACTTGTTTCTCTACCAAAGG - Intronic
1078779485 11:14423385-14423407 TGTACTTATCTCTCTAACAAGGG - Intergenic
1084556891 11:69880788-69880810 TTTACTTATGTTTCTATGAATGG + Intergenic
1085372769 11:76025613-76025635 TGTACTTATGTTTGTTCCTATGG + Intronic
1088296771 11:108306555-108306577 TGTATTTATGTCACAACCATTGG + Intronic
1089018505 11:115187179-115187201 TGTTGTTATTACTCTACCAAGGG + Intronic
1090159250 11:124474941-124474963 TCTACTTATGAGTCTATCAAAGG + Intergenic
1091854715 12:3730203-3730225 TGTACTCATGTCTCTTCAAGGGG - Intronic
1093610729 12:21152164-21152186 TATACTGATGTGTTTACCAAAGG + Intronic
1095661086 12:44737580-44737602 TGGACTTATGTATTTACCATGGG - Intronic
1096765170 12:53881272-53881294 TATACATATGTCTCTGACAAGGG + Intergenic
1099735152 12:86557780-86557802 TGTCCTTATGTTGATACCAATGG - Intronic
1109390978 13:61692681-61692703 TGTAATTATATCTCAACAAATGG - Intergenic
1110245736 13:73322009-73322031 TTTACTTATTTCTCAAGCAAAGG + Intergenic
1114937920 14:27567270-27567292 TGTCCATCTTTCTCTACCAAGGG - Intergenic
1117556085 14:56885743-56885765 TGTGTTTATGTTTCTACTAAAGG + Intergenic
1117730000 14:58712760-58712782 TGTACTTTTTTTTCTAACAACGG - Intergenic
1119464402 14:74843628-74843650 TGTACTTATGTCTCTACCAAAGG - Intronic
1120480161 14:85039197-85039219 TGTCATTATGTATCTGCCAATGG - Intergenic
1121254451 14:92520915-92520937 AGGACTTATCTCTCTACCGATGG + Intronic
1125088637 15:35763651-35763673 TGTACTTTTGTCTCTCAAAAGGG + Intergenic
1127576856 15:60300052-60300074 TGGCCTCATGTCTGTACCAAGGG + Intergenic
1129129725 15:73482723-73482745 TTTACTGATTTATCTACCAATGG + Intronic
1130055196 15:80517775-80517797 TTTACTGATGAGTCTACCAAAGG + Intronic
1135259911 16:20971825-20971847 TGTACTTTGCTCTATACCAAGGG - Intronic
1135487393 16:22878303-22878325 TGTTCTTATTTCTTTAACAAAGG - Intronic
1141543331 16:84744402-84744424 TGTACTTATCTTTCTAGCTAAGG - Intronic
1146492916 17:33294894-33294916 TGTACTGGGGCCTCTACCAAAGG + Intronic
1153414677 18:4833907-4833929 TGTACTCTTGACTCTACAAATGG + Intergenic
1159027744 18:63201401-63201423 TTTACTTATGTATTAACCAAAGG - Intronic
1159330480 18:66987699-66987721 TATTCTTATGTATCTAGCAAGGG - Intergenic
1159809059 18:72994562-72994584 TGTACATATTTCTCAATCAAGGG + Intergenic
1163491851 19:17621345-17621367 TGTACATTTGTGTCTACAAATGG - Intronic
1166500871 19:43340285-43340307 TGTCTTTGTCTCTCTACCAATGG + Intergenic
1166509226 19:43393132-43393154 TGTCTTTGTCTCTCTACCAATGG - Intergenic
1167808507 19:51807613-51807635 TTTACTGATGGCTCTTCCAAAGG - Intronic
928695200 2:33841991-33842013 TGTACTTTTGACTCTTCCCACGG + Intergenic
929871730 2:45764879-45764901 TGTTCTTATGTCTCACACAATGG + Intronic
932478548 2:72024357-72024379 TGTAATTAAGTCTGTAGCAATGG - Intergenic
934890005 2:98059076-98059098 TTTGCTTATGTCTCTGCCTAAGG - Intergenic
935527219 2:104184889-104184911 TGTACTTATATCTATAAGAACGG - Intergenic
939104982 2:137938358-137938380 TGCACTCATATCTCAACCAACGG - Intergenic
940393167 2:153156403-153156425 AGTACATATGTCTCTGACAATGG + Intergenic
942687935 2:178553642-178553664 TGGACTACTGTCTCTACCAAAGG - Exonic
943206012 2:184897081-184897103 TGTAGTTATGTTTATACAAATGG + Intronic
943872693 2:193021853-193021875 TGTATTTATGGATCTTCCAAAGG - Intergenic
947221084 2:227792898-227792920 TCTTCATTTGTCTCTACCAAGGG + Intergenic
1168905481 20:1400035-1400057 TTTACTGATGGCTCTTCCAAAGG + Intergenic
1170129507 20:13003339-13003361 TGTACGTATATGGCTACCAAAGG + Intergenic
1173316979 20:41953832-41953854 TTGAATTATGTCTCCACCAATGG - Intergenic
1177682159 21:24385868-24385890 TGTATTTATCTCTTTATCAAAGG - Intergenic
1178780339 21:35597552-35597574 TGTACTGATGTCACTGCCAATGG - Intronic
950623646 3:14227920-14227942 TTTACTGATGGCTCTTCCAAAGG + Intergenic
951710693 3:25582762-25582784 TGTTCTACTGACTCTACCAAGGG - Intronic
953453110 3:43020459-43020481 TGTAGTGCTGTCTCTACAAATGG - Intronic
954111058 3:48433401-48433423 TGCACTTATGTCTACACAAAGGG + Intronic
959914616 3:111802585-111802607 AGTACTAATGTCTCTTCTAAGGG - Intronic
963446888 3:145423332-145423354 GGTAAATCTGTCTCTACCAAAGG + Intergenic
964285851 3:155117426-155117448 TGTACTTTTTTCTCAACTAAAGG + Intronic
967226100 3:187292529-187292551 TGTATATATGTCTATACCCATGG + Intergenic
970083527 4:12318352-12318374 TGTACTTAAGTCATTTCCAAAGG + Intergenic
972944613 4:44238773-44238795 TATACTTATTTCTTTACTAAGGG + Intronic
973624258 4:52755591-52755613 TCTATTTCTGGCTCTACCAAAGG + Intergenic
973984904 4:56341252-56341274 TGCACTTAAGTGTCCACCAATGG + Intronic
974202391 4:58658087-58658109 TGAAGTTATGACTCTAGCAAAGG - Intergenic
977816390 4:101417796-101417818 TGTACTCATGTATTTACAAATGG - Intronic
983118788 4:163853676-163853698 TGTACTTACTTTTCTTCCAAAGG + Intronic
985299636 4:188474360-188474382 TGTACTTATGTCTTTGAAAATGG + Intergenic
987096304 5:14553579-14553601 GGCACTTCTGTCCCTACCAAAGG - Intergenic
988684184 5:33512055-33512077 TGTCCTTGAGTCTCTGCCAAAGG + Intergenic
992754785 5:79894141-79894163 TGTTATTATCTATCTACCAAGGG - Intergenic
997896680 5:137724971-137724993 TATACATATGTCTCAACCTAAGG + Intronic
1001612500 5:173014372-173014394 TATACTGATTTCTCTACCACTGG - Intronic
1005946540 6:30600030-30600052 TGTACTAATGTATCTAACACAGG + Intergenic
1006228684 6:32563180-32563202 TTTACTGATGGCTCTTCCAAAGG - Intronic
1006260728 6:32867210-32867232 TGTATTTATTTCTCTGGCAAAGG + Intergenic
1009157744 6:60243882-60243904 TGTACATATTTCTCCACCGAAGG - Intergenic
1012808190 6:103922498-103922520 TGTTGTTATCTCTCTTCCAACGG - Intergenic
1013682262 6:112537689-112537711 TGTGTTTGTGTCTCTACAAAGGG - Intergenic
1014739657 6:125133732-125133754 TGTACTTTTGTGTTTAGCAAGGG - Intronic
1021395733 7:20145683-20145705 TGTATTTATGTTTCTGCCAAAGG - Intronic
1023758597 7:43443454-43443476 TGTCCTTATGGCTACACCAAAGG - Intronic
1024743550 7:52381778-52381800 TGTATGTATGTCTCTCACAATGG - Intergenic
1024983997 7:55180424-55180446 TGTATTTATGGCTCTGTCAAAGG + Intronic
1026549892 7:71359110-71359132 TGTACTTGTGACACTAACAATGG - Intronic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1035888520 8:3319963-3319985 TAGACTTAAGTCTCTACCAGTGG + Intronic
1036702041 8:11019354-11019376 TGTTCTTGTGTCTTTACCAGGGG - Intronic
1036793502 8:11739307-11739329 TGTACTCATTCCTCTACCATTGG + Intronic
1037174502 8:15930970-15930992 AGTACGAATGTCACTACCAATGG - Intergenic
1037933240 8:22896679-22896701 TGTAATGCTGTTTCTACCAAGGG - Intronic
1040345325 8:46487086-46487108 TTTACTGATGGCTCTTCCAAAGG - Intergenic
1041297400 8:56372729-56372751 TATAATTATCTCTCTTCCAAAGG + Intergenic
1044711795 8:95065454-95065476 TGTACTTATATGTATGCCAAGGG - Intronic
1048083198 8:131150748-131150770 TTAAGTTAGGTCTCTACCAATGG + Intergenic
1048902071 8:139048415-139048437 TGTAATTATGTTTCTACATATGG + Intergenic
1051407411 9:16753965-16753987 GGTACTTGTGTCACAACCAATGG + Intronic
1053823106 9:41990208-41990230 TGTACTTATTTCCCTAACACTGG + Intronic
1056039559 9:82648755-82648777 TGTAGTTATGTGTGTACAAATGG - Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1186169404 X:6860900-6860922 TTTACTTATTTCTCTTCCAAGGG - Intergenic
1186384205 X:9092622-9092644 TGTCCTTATGTCTCTGTTAAAGG + Intronic
1186630888 X:11347812-11347834 TGGACTTATGTTTCTATTAATGG - Intronic
1187643907 X:21325766-21325788 TCTACTGATGTGTCCACCAAAGG + Intergenic
1188142543 X:26569587-26569609 TGTCTTCATGTCTTTACCAAAGG + Intergenic
1189068114 X:37833540-37833562 TTTCATTATGTCTCTACCCAGGG + Intronic
1189236527 X:39491278-39491300 TATACCCATGTCTCTATCAAAGG + Intergenic
1189675836 X:43459605-43459627 TGTACTTATGTCTCATCAGATGG + Intergenic
1195693750 X:107651052-107651074 TGTACTGATCTCTCTGCTAAAGG + Intergenic
1195848071 X:109249781-109249803 GGTACTTACATTTCTACCAATGG + Intergenic
1196275187 X:113758380-113758402 TGTATTTATGTCTTTGCTAAAGG - Intergenic
1201518509 Y:14845810-14845832 TGTACTTAAATCTCTAAGAATGG + Intergenic
1202353480 Y:24019626-24019648 TTTACTGATGGCTCTTCCAAAGG - Intergenic
1202517299 Y:25650489-25650511 TTTACTGATGGCTCTTCCAAAGG + Intergenic