ID: 1119472641

View in Genome Browser
Species Human (GRCh38)
Location 14:74909366-74909388
Sequence GGCTCCTGGGAGTACCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119472641_1119472647 1 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472647 14:74909390-74909412 CGGCCAACAGACTCCAGCCTAGG 0: 1
1: 0
2: 4
3: 154
4: 3327
1119472641_1119472651 17 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472651 14:74909406-74909428 GCCTAGGCCCCCTGAAAGGCTGG 0: 1
1: 1
2: 5
3: 104
4: 2231
1119472641_1119472661 29 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472661 14:74909418-74909440 TGAAAGGCTGGCTGGGGCCAGGG 0: 1
1: 0
2: 4
3: 64
4: 608
1119472641_1119472649 13 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472649 14:74909402-74909424 TCCAGCCTAGGCCCCCTGAAAGG 0: 1
1: 1
2: 0
3: 27
4: 339
1119472641_1119472655 23 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472655 14:74909412-74909434 GCCCCCTGAAAGGCTGGCTGGGG 0: 1
1: 0
2: 1
3: 20
4: 275
1119472641_1119472660 28 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472660 14:74909417-74909439 CTGAAAGGCTGGCTGGGGCCAGG 0: 1
1: 0
2: 5
3: 64
4: 543
1119472641_1119472654 22 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472654 14:74909411-74909433 GGCCCCCTGAAAGGCTGGCTGGG 0: 1
1: 0
2: 0
3: 23
4: 192
1119472641_1119472653 21 Left 1119472641 14:74909366-74909388 CCCACAGGGTACTCCCAGGAGCC 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1119472653 14:74909410-74909432 AGGCCCCCTGAAAGGCTGGCTGG 0: 1
1: 0
2: 8
3: 25
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119472641 Original CRISPR GGCTCCTGGGAGTACCCTGT GGG (reversed) Intronic
900653948 1:3745850-3745872 TCCTCCGGGGAGCACCCTGTGGG + Intergenic
900747049 1:4367591-4367613 GGCTGCAGGGAGGACCATGTGGG + Intergenic
901813434 1:11780450-11780472 GACTCCTGGGTGTGCCCTGTGGG - Intronic
902041084 1:13492951-13492973 CGCTCTTGGGAGTTCCCTGGGGG + Intronic
903069058 1:20717749-20717771 GGCTGCTGGGAGTCCCCGGCGGG - Exonic
903261450 1:22133794-22133816 GCCTCCTGGGAGGAGCCTGCAGG - Intronic
904141853 1:28359797-28359819 GGTTCCTGGAAGTACCTGGTGGG - Intergenic
905513432 1:38542712-38542734 GGCTCCTGGTAGCAACCTGGAGG + Intergenic
906689930 1:47785829-47785851 GACTCCTGGGAGCTCCCTGTTGG + Intronic
907039729 1:51247758-51247780 GGCCCCTGGGAGTACACTCTAGG - Intronic
912815752 1:112826720-112826742 GGCTGGTCGGAGTACCCCGTAGG - Intergenic
920249038 1:204610179-204610201 GCATCCTGGGACCACCCTGTGGG + Intergenic
920261290 1:204689710-204689732 GGATCCTGGGAGCTCCCTGAGGG - Intergenic
920656436 1:207879032-207879054 GGCTACAGGGAGTTCCATGTGGG - Intergenic
922745336 1:228039959-228039981 GGCTCCTGGGACATGCCTGTTGG - Intronic
1067261809 10:44699568-44699590 GGCTCCTGGGAGAATACAGTGGG + Intergenic
1070060857 10:72981566-72981588 GCCTTCTAGGAGCACCCTGTAGG + Intergenic
1070782028 10:79143199-79143221 GGCTCCTGAGTGTACCTTTTTGG + Intronic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1073410655 10:103339067-103339089 GGCTATTGGGGGTAACCTGTAGG - Intronic
1076889387 10:133276438-133276460 GGTTCCTGGGATTCACCTGTGGG - Intronic
1077385397 11:2267306-2267328 GGATTCTGGGAGAAGCCTGTGGG + Intergenic
1078351754 11:10600765-10600787 AGCTGCTGGGAGGCCCCTGTGGG + Intronic
1078775560 11:14390390-14390412 GGCTTCTGGGAGTAAACTTTGGG - Intergenic
1079658952 11:23017131-23017153 AACTCCAGGGAGTAACCTGTTGG - Intergenic
1084165735 11:67373919-67373941 GGCTCCTGGGAGTCCTCAGACGG - Intronic
1084472392 11:69370685-69370707 GGCTCCTGACAGTTTCCTGTGGG + Intergenic
1084484309 11:69439036-69439058 GGTCCCTGGGAGGACCCTGGGGG - Intergenic
1091169344 11:133506603-133506625 GGATCCTGGGAGAACAGTGTGGG + Intronic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1097886619 12:64735170-64735192 GGCTCCTTGGTGTACCGTGCTGG + Intronic
1104971043 12:132530801-132530823 GGAGCCTGGGAGGACCCTGAGGG + Intronic
1106836674 13:33642543-33642565 GGCTCCTGGGAGTCACCCCTTGG - Intergenic
1114930871 14:27466167-27466189 GGTTTCTGGGATTACTCTGTTGG - Intergenic
1115643451 14:35350327-35350349 GGCTCCTGGGAGCACCCACAGGG + Intergenic
1117982271 14:61353555-61353577 AGGCCCTTGGAGTACCCTGTGGG + Intronic
1119472641 14:74909366-74909388 GGCTCCTGGGAGTACCCTGTGGG - Intronic
1121922952 14:97900030-97900052 GGGTCCTGGGACTACACTTTGGG + Intergenic
1133700286 16:8302291-8302313 GGCTGCTAGGGGTACCTTGTGGG - Intergenic
1135496558 16:22956713-22956735 GGCTCCTGGGGTCACTCTGTGGG - Intergenic
1135767066 16:25186943-25186965 GGCTCCTGGGAATTCCATCTAGG - Intergenic
1136611847 16:31371276-31371298 GGCTCCTGGGAGCACCACGTGGG - Intronic
1137061186 16:35792912-35792934 GGATCGTGGGACTATCCTGTGGG + Intergenic
1140702723 16:77597396-77597418 GGACACTGGGAGTCCCCTGTTGG + Intergenic
1142851401 17:2706522-2706544 GGTTCCTGGGAGTCCACTGCAGG - Intronic
1143799582 17:9367508-9367530 GGTTCCTGGGAGTATCCTAATGG + Intronic
1144415082 17:15038702-15038724 CACACCTGGGAGTACCCTGCAGG + Intergenic
1147537070 17:41328023-41328045 GGCTCCTGGGACTGCCTTCTGGG - Intergenic
1147742181 17:42675807-42675829 GGCTCCTGGGAAACCCCTGAGGG - Intronic
1148130187 17:45257645-45257667 GGGTCCTGGGAGTAGCCGGTGGG - Intronic
1155110806 18:22712528-22712550 GGCACCTGGGAAGGCCCTGTGGG - Intergenic
1160528344 18:79549874-79549896 GTCTCCTGGGAGCTCCCTCTCGG - Intergenic
1162895534 19:13762964-13762986 GCCTCCTGGGAGGAGCCTGCTGG - Exonic
1162975021 19:14203615-14203637 GGGGCCTTGGAGGACCCTGTGGG - Intronic
1164781388 19:30896399-30896421 GGCTCCTGGGAGCAGCCTCCTGG - Intergenic
1167080845 19:47275203-47275225 GCCTCCTGGGAGTCCCCGGCGGG + Exonic
1168666246 19:58207240-58207262 GGTGTCTTGGAGTACCCTGTGGG + Intronic
925146673 2:1587206-1587228 GGTTCCAGGGAGGGCCCTGTGGG - Intergenic
926700487 2:15800121-15800143 TGCTCCTGGGCTTGCCCTGTAGG - Intergenic
927425281 2:22974712-22974734 GGCTCTTGGTTCTACCCTGTGGG - Intergenic
931242296 2:60464016-60464038 GGCTCCTGAGAAGACCCTGCCGG - Intronic
932469011 2:71941866-71941888 AGCTCTTGGCAGAACCCTGTGGG - Intergenic
934662144 2:96148720-96148742 GGCGCCTGGCAGGAGCCTGTGGG - Intergenic
935214996 2:100968923-100968945 GGTTCCTGGGAGGTCCCTGCTGG + Intronic
935691948 2:105740198-105740220 GGGACGTGGGAGGACCCTGTAGG - Intergenic
937242056 2:120468205-120468227 GTCTCCCAGGAGCACCCTGTTGG + Intergenic
937320409 2:120957389-120957411 GGCTTGTGGGAGCACCGTGTAGG - Intronic
940152275 2:150615676-150615698 GGCTCCAGGAAGAACCCTGAGGG + Intergenic
948004898 2:234600068-234600090 GGCTCCTGGGAGTTGCTGGTTGG + Intergenic
948681274 2:239636312-239636334 GGCTCCTGGGAGTTCTCTTTGGG - Intergenic
1169198664 20:3697080-3697102 TGCTCCTGAGTGTACTCTGTGGG - Exonic
1169274425 20:4224068-4224090 GGGTCCTGGGAATATCCTATAGG + Intronic
1170223028 20:13961716-13961738 GGCTCTTGGCAATACCCTCTGGG - Intronic
1172284578 20:33731917-33731939 GGCTCCTGGGCGCCCCCTGGCGG + Exonic
1178293752 21:31391271-31391293 GACTCCTTGGAATACCATGTGGG - Intronic
1178357308 21:31919773-31919795 GGCTCCTGAGACTACGCTGAAGG + Intronic
1178442756 21:32612171-32612193 GGCGCCTGGGAGTACCGAGCTGG - Exonic
1179204836 21:39266364-39266386 GGCTCCTAGAAGGACCATGTGGG - Intronic
1179451904 21:41473632-41473654 GGCTCCTGGGGGTCTCCTCTTGG + Intronic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1181458890 22:23074649-23074671 GGCTCCTGGGCCTCCACTGTGGG + Intronic
1181512891 22:23396642-23396664 GGTTCCTGGGATTCCCCTGTGGG + Intergenic
1183548419 22:38467723-38467745 AGCACGTGGAAGTACCCTGTGGG - Intergenic
1183951515 22:41355462-41355484 GTGTCCTCGGAGCACCCTGTGGG - Exonic
1184168223 22:42743244-42743266 GGGTCCTGGGAGGACCCTGCAGG + Intergenic
1184801346 22:46762415-46762437 GGCTCCTGGGAGTCCGTTGCGGG + Intergenic
951248838 3:20370874-20370896 GGCTGTTGGGAGTTCCCTGCAGG + Intergenic
952604540 3:35129025-35129047 GGTTGCTGGGAGGATCCTGTAGG - Intergenic
953882271 3:46696757-46696779 AGCTCCTGTGAGTTTCCTGTAGG - Intergenic
956716842 3:72086934-72086956 GGGTCCTGGGAGTCCCCGGCGGG + Intergenic
956765078 3:72477908-72477930 TGCTCCTGGGACTTCCCAGTGGG + Intergenic
959871333 3:111331806-111331828 GGCCCTTGGGTCTACCCTGTAGG - Intronic
961869439 3:129977059-129977081 GGGCCCTGGGAGGCCCCTGTGGG + Exonic
964769855 3:160212879-160212901 GGCTCCTAGAAGTACCATTTTGG - Intergenic
966137391 3:176714400-176714422 GGATCCTGGGACCACCCTTTAGG - Intergenic
969345101 4:6564977-6564999 GGCTCCTGGGAGGACCCTGGAGG - Intergenic
969564888 4:7971743-7971765 GGAAGCTGGGAGTACCCTGAGGG - Intronic
969619400 4:8271455-8271477 GGTTCCTGGGAGCCCCGTGTGGG + Intronic
969787975 4:9473842-9473864 GGCTCTTGGGAGCCCCATGTCGG + Intergenic
970820259 4:20204142-20204164 TGCACTAGGGAGTACCCTGTGGG + Intergenic
981077688 4:140607403-140607425 GGTGCCTAGGAGTTCCCTGTTGG - Intergenic
985338374 4:188920690-188920712 GGTTACTGGGAGTAACCTATTGG - Intergenic
986611365 5:9571129-9571151 GGCTCCTGGAAGGAGCCTTTCGG - Intergenic
996342864 5:122457509-122457531 AGCACCTGGGGGTACACTGTGGG - Intronic
997295024 5:132763743-132763765 GACTTCAGGGAGTGCCCTGTGGG + Exonic
1000042870 5:157498161-157498183 TTCTCCTGGAAGGACCCTGTGGG - Intronic
1002159600 5:177307484-177307506 GGCTGCTCGGAGTCACCTGTTGG - Exonic
1003248061 6:4400899-4400921 TGCTCCTGGGAGAGCCCTGAAGG + Intergenic
1004709549 6:18156099-18156121 GGCTCCTGGCCGCACCCTATCGG - Intronic
1005958571 6:30681147-30681169 GCATACTGGGAGCACCCTGTAGG - Intronic
1011551562 6:88535368-88535390 GGCTCCTGGGAATCCCCAGGAGG - Intergenic
1015398849 6:132766038-132766060 GTATCATGGGACTACCCTGTGGG + Intergenic
1017670286 6:156764120-156764142 GGCTCCTGGGGAGGCCCTGTGGG + Intergenic
1018652400 6:166003124-166003146 GGCTCCTGGGTGCAGCCTGCTGG - Intergenic
1024059211 7:45685739-45685761 GGCTCCAGGGAGGACCAGGTGGG - Intronic
1029222940 7:99004480-99004502 AGCTCCAGGGTGGACCCTGTGGG + Intronic
1030059650 7:105612581-105612603 GCCTCCAGGGAGAGCCCTGTGGG + Intronic
1035256510 7:157632199-157632221 GACTCCAGGAAGTACCCTGCAGG - Intronic
1035354539 7:158269172-158269194 GGCTCCTAGGAGGCCCCTTTGGG - Intronic
1038658588 8:29476822-29476844 GGCTCCTTGGAGTTCCGTGGAGG - Intergenic
1040338150 8:46426668-46426690 GGCTTCTGGGATAACCCTGGGGG - Intergenic
1043928862 8:86068385-86068407 GCCTCCTGAGTGTACCATGTTGG - Intronic
1047459508 8:125048872-125048894 GGCTCCTGAAAGTACTCTGAAGG + Intronic
1056852444 9:90095840-90095862 AGCTCCTGGTAGAAGCCTGTGGG - Intergenic
1057159302 9:92875446-92875468 GGCTTCTGGGAGTAGTCTCTGGG - Intronic
1061870409 9:133517275-133517297 GGCCCCTGGGAGTCACCTGGTGG - Intronic
1062004719 9:134233429-134233451 GGCTTCTGGTGGCACCCTGTGGG - Intergenic
1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG + Intronic
1062204017 9:135325820-135325842 GGCTCCTGGGTTTGCCCTCTGGG + Intergenic
1192038511 X:67591590-67591612 GCCTCCTTGGAGAGCCCTGTTGG - Intronic
1201422536 Y:13815420-13815442 GGCTCCAGGCAGTAAACTGTGGG + Intergenic