ID: 1119473602

View in Genome Browser
Species Human (GRCh38)
Location 14:74914069-74914091
Sequence ATGGAGAAACAGGCTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 845
Summary {0: 1, 1: 4, 2: 26, 3: 112, 4: 702}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119473602_1119473606 -10 Left 1119473602 14:74914069-74914091 CCCTCCTGAGCCTGTTTCTCCAT 0: 1
1: 4
2: 26
3: 112
4: 702
Right 1119473606 14:74914082-74914104 GTTTCTCCATCATCAGTGAAAGG 0: 1
1: 0
2: 2
3: 17
4: 213
1119473602_1119473607 -6 Left 1119473602 14:74914069-74914091 CCCTCCTGAGCCTGTTTCTCCAT 0: 1
1: 4
2: 26
3: 112
4: 702
Right 1119473607 14:74914086-74914108 CTCCATCATCAGTGAAAGGAAGG 0: 1
1: 0
2: 4
3: 17
4: 239
1119473602_1119473609 0 Left 1119473602 14:74914069-74914091 CCCTCCTGAGCCTGTTTCTCCAT 0: 1
1: 4
2: 26
3: 112
4: 702
Right 1119473609 14:74914092-74914114 CATCAGTGAAAGGAAGGCAGTGG 0: 1
1: 1
2: 4
3: 64
4: 430
1119473602_1119473610 20 Left 1119473602 14:74914069-74914091 CCCTCCTGAGCCTGTTTCTCCAT 0: 1
1: 4
2: 26
3: 112
4: 702
Right 1119473610 14:74914112-74914134 TGGACTAGATGAGAGCGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119473602 Original CRISPR ATGGAGAAACAGGCTCAGGA GGG (reversed) Intronic
900477942 1:2884754-2884776 AAGGAGTCACAGGCTCAGGGAGG + Intergenic
902290954 1:15434387-15434409 ATGGAGAAAGGGGCCCATGAAGG + Intergenic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902443752 1:16448425-16448447 ATGGAGGAGCAGGCCCAGAAAGG - Intronic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903390745 1:22962055-22962077 AAGGAGACAGAGGCTCAGAAAGG - Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903765005 1:25728403-25728425 TGAGAGAAACAGGCTCAGGGAGG + Intronic
903787692 1:25872297-25872319 TTGGAGAAACAGGGCCAAGAGGG - Intergenic
903803200 1:25985215-25985237 CTGGGCAAACAGGCTCTGGAAGG - Intronic
903891905 1:26575339-26575361 ATGGGGAAACAGGCTCAAGTTGG + Intergenic
904383978 1:30129758-30129780 AGGGAGAAACAGGCTCTTGGAGG - Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904535519 1:31196939-31196961 ACCAAGAAACAGGCACAGGAAGG - Intronic
904562233 1:31406653-31406675 ATAGAGAAACAGGCCCAGAAAGG + Intergenic
904617900 1:31759888-31759910 AGAGGGAAACAGGCTCAGGGGGG - Intronic
904709474 1:32417989-32418011 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905431989 1:37931359-37931381 ATGGAGCAACAGGCCCAGAGAGG + Intronic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905546338 1:38803197-38803219 ATGGAAAAACAGGCACAGAGAGG - Intergenic
905646388 1:39627309-39627331 ATGGGGAGACAGGCTCAGAGAGG - Intronic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
905732329 1:40305562-40305584 ATAGGGAAACAGGCCCAGGGAGG + Intronic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
907159381 1:52359641-52359663 TAGGGGAAACAGGCTCAGAAAGG - Intronic
907275028 1:53312175-53312197 ATGGGGAAACAGGCCAGGGAGGG + Intronic
907394308 1:54178596-54178618 ATGGAGGGACAGGCTGAGGTGGG + Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
908495769 1:64693269-64693291 ATGGATATAGATGCTCAGGAAGG - Intergenic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909986509 1:82167261-82167283 ATGAAAAAAAAGGCTCAGGCAGG - Intergenic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910667207 1:89738766-89738788 ATGGAGGAAAAGGCTCATGAAGG + Intronic
910924108 1:92380743-92380765 ATTCAGAAACATTCTCAGGAAGG + Exonic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912499973 1:110115167-110115189 AGGGAGGAACAGGGGCAGGAGGG - Intergenic
912553432 1:110499151-110499173 ATGGAAACAGAGGCTCAGCAGGG + Intergenic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914386952 1:147178947-147178969 CTGGAGAAACAGGGTAATGATGG + Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916790703 1:168122559-168122581 ATGGAGAGCCAGGCCCTGGAGGG - Intronic
916996795 1:170309876-170309898 AAGGGGAAACAGTCTCAGTAGGG - Intergenic
917013349 1:170500696-170500718 ATACAGAAACAGGTTCAGAAAGG - Intergenic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918001085 1:180496912-180496934 ATGAAGAGAGAAGCTCAGGAGGG + Intronic
918044325 1:180932352-180932374 ATGGAGAAAGAGGCCCACGAAGG - Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919975232 1:202606215-202606237 ATGGGGAAACAGGTTCAGAGAGG + Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
921319795 1:213927644-213927666 CAGGAGATACAGGCTCAGGGAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922022864 1:221721748-221721770 AGGGAAAAGAAGGCTCAGGAGGG + Intronic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922495181 1:226051581-226051603 ATGAGGAAATAGGCTAAGGAAGG - Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
922802207 1:228369620-228369642 ATGGGGATCCAGGCTCAGGCTGG - Intronic
922802328 1:228370166-228370188 AGGGAGAGGAAGGCTCAGGAGGG - Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
1063194574 10:3729512-3729534 AAGGAGAAAAGGGCTCAGAATGG - Intergenic
1063604372 10:7509272-7509294 ATGGGCAAACAGGCTCAGAGAGG + Intergenic
1064426273 10:15232425-15232447 ATGGCGAAACAAGCTGGGGAAGG - Intronic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1064942224 10:20747619-20747641 AAGGAAACAGAGGCTCAGGAAGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067294167 10:44965226-44965248 CTGGTGAAACAGGCTATGGAAGG + Intronic
1067548856 10:47219154-47219176 ATGGCCAGACAGGATCAGGATGG - Intergenic
1067977425 10:51041979-51042001 ATGGAGACTCAGGTTCAGGCAGG - Intronic
1068496761 10:57792532-57792554 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069827294 10:71262088-71262110 ATGGAGAAGCCAGCTCAGGCTGG - Intronic
1069842106 10:71346354-71346376 ATGGGAAAACAGGCTCATGGAGG + Intronic
1070547573 10:77464663-77464685 AGTGAGAAACAGGGCCAGGACGG + Intronic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1071052229 10:81464903-81464925 ATGGTAAAACAGCCTCAGGCAGG - Intergenic
1071430547 10:85603158-85603180 AAGGAGGCTCAGGCTCAGGAAGG + Intronic
1071494294 10:86157126-86157148 AAGGAGGAACAAGCTTAGGATGG + Intronic
1071701119 10:87937654-87937676 ATGATCAAACAGGCACAGGAAGG + Intronic
1071879067 10:89874971-89874993 TTGGAGAAATAGCCACAGGATGG + Intergenic
1072374961 10:94804701-94804723 GTGGACAAACAGCCTCATGATGG - Intronic
1072523987 10:96255182-96255204 AAGGATAAACAAGTTCAGGAAGG + Intronic
1072535832 10:96362090-96362112 CTAGAGAACCAGGCTCTGGAAGG + Intergenic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073186019 10:101615469-101615491 AATGAGACACAGGCTGAGGAGGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1075733248 10:124648690-124648712 ATGAGCAAACAGGCTCAGAAAGG + Intronic
1075922414 10:126224464-126224486 AGGGAGAAACAAGCACAGGAAGG + Intronic
1076032602 10:127172340-127172362 CTGGAACAACAGGCTCTGGAGGG - Intronic
1076079952 10:127570320-127570342 GTGGAGGATCAGCCTCAGGAGGG + Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1078713132 11:13814262-13814284 ATGAAGAAAGAGGCCCACGAAGG - Intergenic
1078730245 11:13966813-13966835 ATGGAGAAATTGGCTCAGAGAGG - Intronic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080582687 11:33656950-33656972 ATAGAGAAACAGGGGCTGGAGGG - Intronic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080804033 11:35635578-35635600 ATGGGGAAACAGGCACAGAGTGG + Intergenic
1081651296 11:44825805-44825827 ATGGAGAAACAAGCCCACCAGGG - Intronic
1081678048 11:44982442-44982464 AGGAAGAAAAAGGCTCTGGACGG - Intergenic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082081934 11:48019042-48019064 ATGGAGAACCCCTCTCAGGAGGG + Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083160984 11:60853909-60853931 AGGCAGAAAAAGGCTCGGGAAGG - Intronic
1083247089 11:61437140-61437162 AAGGAAACAGAGGCTCAGGAAGG - Intronic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084130563 11:67130884-67130906 ATGGAGAGAGAGGCCCAGGGAGG + Intronic
1084155161 11:67309190-67309212 ATGGGGAAACAAGCCCAGCAGGG + Intronic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084775597 11:71372616-71372638 AAGAAGAAACAGGCCCTGGAGGG + Intergenic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085245347 11:75096755-75096777 ATGGGGAGATAGGCTCAGGGAGG - Intergenic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085721883 11:78919640-78919662 AAAGGGAAACAGGGTCAGGAGGG + Intronic
1085848806 11:80096767-80096789 GTGGAGAAACACGATCATGATGG + Intergenic
1086286689 11:85259685-85259707 ATGGAGAGACAGGTTCAGATGGG - Intronic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088530226 11:110800081-110800103 ATGGGGACACAGGCTCTGGGTGG + Intergenic
1088971828 11:114780672-114780694 ATGCTGTAAGAGGCTCAGGAAGG + Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089654732 11:119938962-119938984 GTGGAGACACAGGCTCAGTGTGG + Intergenic
1089699617 11:120236598-120236620 AGGGAGTATCAGGCTCAGGGGGG + Intergenic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1090024423 11:123155529-123155551 ATGGAGAAACCAGCTCAGAGGGG + Intronic
1090132289 11:124157285-124157307 ATTGAGAAACAGTATCAGCAAGG - Intergenic
1091303894 11:134524381-134524403 ATGGGGAACAAGGTTCAGGAGGG - Intergenic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091629116 12:2145919-2145941 ATGGAAACTGAGGCTCAGGAGGG - Intronic
1091854424 12:3727939-3727961 ATGAGGAAACAGGCCCAAGAGGG + Intronic
1091935116 12:4428824-4428846 ATGGGGAAATTGGCCCAGGAGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092974215 12:13728563-13728585 ATGGAGAAAAAGGCCAAAGAGGG + Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1095223985 12:39656591-39656613 ATTGTAAAACAGGCTCAGGCAGG + Intronic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095814752 12:46408850-46408872 ATGGAGAAACGTGAACAGGAAGG + Intergenic
1096156960 12:49346303-49346325 ATGGAGGAACAAGCGAAGGAAGG - Intergenic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096311484 12:50525045-50525067 ATGGAGAAAAAGCATCAAGAGGG + Intronic
1096403960 12:51329360-51329382 AGGGAAAAACAGGTTCAGAAAGG - Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097187407 12:57203147-57203169 AGGGGGAGACAGGCCCAGGAGGG - Intronic
1097880409 12:64681403-64681425 ATGAGGGAACAGGCTCAGAAAGG + Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098862135 12:75722054-75722076 ATATAGAAACAGGCTCGGAAAGG + Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100012867 12:89974582-89974604 CTGTAAAAACAGTCTCAGGAAGG - Intergenic
1100123653 12:91397336-91397358 GAGGAGTAAAAGGCTCAGGAGGG - Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101041412 12:100759737-100759759 ATGGGGAAACGGGCTCAAAATGG - Intronic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101608460 12:106268438-106268460 ATGGAGAAATAGGAACAGAAAGG + Intronic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1102522494 12:113487347-113487369 AAGGAACAACAGGCTCAGAAGGG - Intergenic
1102566041 12:113798131-113798153 ATGGAGACCCCGGCCCAGGAAGG - Intergenic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103181408 12:118915117-118915139 AAGAAGAAACAGGCTCTGAAAGG + Intergenic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103374548 12:120445746-120445768 AGAGAGAAACAGGCTAACGAAGG + Intronic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104478165 12:129087576-129087598 ATGGAGGCAGAGGCCCAGGAAGG + Intronic
1104739653 12:131163631-131163653 ACAGAGAAACAGGGTCAGGCCGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105260432 13:18775247-18775269 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105262637 13:18791101-18791123 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1105701573 13:22939004-22939026 GTGGAGAAAAAGGCACAGGTGGG - Intergenic
1106150307 13:27094211-27094233 GTGGAGAAACTGGCCCAGCACGG + Intronic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1108379773 13:49844635-49844657 ATGTAGAAACAGGCTCACAGAGG - Intergenic
1108393899 13:49974432-49974454 ATGGAGAAACAGGCCGGGTACGG - Intergenic
1108486200 13:50928738-50928760 ATGTGGAAACAGCCACAGGAAGG + Intronic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108824037 13:54390162-54390184 CTTGAGGAACAGTCTCAGGAGGG + Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112185645 13:97125531-97125553 AGGGAGAAGCAGGCTCATGGGGG - Intergenic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113916546 13:113877381-113877403 AAGGAGGAAGGGGCTCAGGAGGG + Intergenic
1114037000 14:18638739-18638761 AAGGAGCAAAAAGCTCAGGAAGG + Intergenic
1114121639 14:19676305-19676327 AAGGAGCAAAAAGCTCAGGAAGG - Intergenic
1114535305 14:23418676-23418698 AGAGGGAAACAGGCTCAGAAAGG + Intronic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117505675 14:56400553-56400575 CTGGAAAAACAAGCTCAGCAAGG + Intergenic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1118319777 14:64746453-64746475 TTGGACAAACAAGCTCAGGGAGG - Exonic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118671405 14:68132009-68132031 AGGAAGAATCAGGCTCAGAAAGG + Intronic
1118772034 14:68948619-68948641 ACGGAAAAACAGGCTCGAGAGGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121813007 14:96907939-96907961 ATGGAGAAAAAGGCACATCATGG + Intronic
1121844677 14:97162322-97162344 ATACACAAACAGGCTCAGGCTGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122229716 14:100299716-100299738 CAGGAGAAACAGGCTCAGTGAGG + Intronic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123059211 14:105586854-105586876 ATGGACAGACAGGCGCCGGATGG + Intergenic
1123083542 14:105707085-105707107 ATGGACAGACAGGCGCCGGATGG + Intergenic
1123101857 14:105808868-105808890 AGGAAGAAAAAGGCTAAGGAAGG - Intergenic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1124490891 15:30154559-30154581 ATGGGGAAACAGGTTCAGAGAGG + Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124632151 15:31344149-31344171 CTGGAGTGACAGGCTCAGGGTGG - Intronic
1124752642 15:32383772-32383794 ATGGGGAAACAGGTTCAGAGAGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126451027 15:48809943-48809965 ATGGGGGAACAGGCTTGGGAGGG - Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126953498 15:53909429-53909451 ATGAGGAGACAGGCTCAAGAAGG + Intergenic
1127317036 15:57806814-57806836 AAGGAGAAACAGACTCATAAAGG - Intergenic
1127361220 15:58246641-58246663 GTGGAGCCTCAGGCTCAGGAAGG + Intronic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128705869 15:69837095-69837117 ATGGAGACTGAGGCTCAGAAAGG + Intergenic
1128907211 15:71477792-71477814 AAGGAGAAGCAGGTTCAGCATGG - Intronic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1128979833 15:72178175-72178197 AGGGTGAAGAAGGCTCAGGAGGG - Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129505962 15:76081648-76081670 ATGGACACTCAGGTTCAGGAAGG - Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1130785662 15:87093118-87093140 TTGGAGACTCAGGCTCAGGTTGG + Intergenic
1130988588 15:88860996-88861018 AAGGACAAACAGGCTCATGGTGG - Intronic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132709159 16:1258841-1258863 ATGGAGGAGGGGGCTCAGGATGG - Exonic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133901333 16:9978063-9978085 ATGGAAGAAAAGGCTCAGAAAGG - Intronic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135091726 16:19523007-19523029 ATGCAAAAACAGGCACTGGAAGG + Intergenic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1136014240 16:27384882-27384904 CGGGAGAAACTGCCTCAGGATGG - Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138681083 16:58684190-58684212 ATAGGAAAACAGGCCCAGGAGGG + Exonic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1140552937 16:75887167-75887189 AAGGAGCAACAGCCTAAGGAAGG + Intergenic
1141220765 16:82067621-82067643 ATAGGGAAAAAGGCCCAGGAGGG + Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141671642 16:85495150-85495172 AGGGAGAGAAAAGCTCAGGATGG + Intergenic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141910787 16:87057072-87057094 AAGGAAATCCAGGCTCAGGAAGG - Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1142001721 16:87668132-87668154 AAGGAGGAACAGGCTCAGGCAGG - Intronic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142326125 16:89415853-89415875 ATGGAGAACCAGCCTCAGTGAGG + Intronic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203051735 16_KI270728v1_random:881346-881368 ATTCAGGAAGAGGCTCAGGAAGG + Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1145225640 17:21125939-21125961 ATGAATAAACTGGCTCTGGAAGG + Intronic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1146950514 17:36902162-36902184 CTGGAGAAAGAGGCTCCTGATGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147744943 17:42689213-42689235 AAGGTGATACATGCTCAGGATGG + Intronic
1147836748 17:43338306-43338328 ATGGATAACCAGGCTGTGGAGGG + Intergenic
1147864232 17:43542500-43542522 AGGGAGACCCAGGCTCAGGCAGG - Intronic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148216887 17:45838149-45838171 AAGGAGAAATGGGCTCAGGTGGG - Intergenic
1148355267 17:46971659-46971681 ATGAAGAAACAGGCCTTGGAAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1150655962 17:67039843-67039865 AGCAAGAAACAGGCTCAGAAAGG + Intergenic
1150924709 17:69520770-69520792 ATGGCTATTCAGGCTCAGGAGGG + Intronic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151355833 17:73558015-73558037 ATAGAGCAACAGGGTGAGGAGGG - Intronic
1151542316 17:74770872-74770894 GTGGAGGCACAGGCTCAGGGTGG - Exonic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152158035 17:78647747-78647769 ATGGTGAAGGAGGCTCCGGAGGG + Intergenic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152366655 17:79860378-79860400 AATGATAAACAGGCTCAGGCGGG - Intergenic
1152771901 17:82175192-82175214 CTGGAGAAACAGTCGCATGAGGG + Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153712381 18:7812776-7812798 ATGGAGAAATTGGGTCTGGATGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154305371 18:13226910-13226932 ATGGAGAATGAGGGCCAGGAGGG + Intronic
1154314107 18:13290252-13290274 ATGGAAAACCAGGGACAGGAAGG - Intronic
1154324533 18:13380340-13380362 CAGGAGACACTGGCTCAGGAGGG - Intronic
1154425587 18:14269548-14269570 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428321 18:14289133-14289155 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154428803 18:14292607-14292629 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154431083 18:14308952-14308974 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433279 18:14324789-14324811 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154433753 18:14328261-14328283 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155154202 18:23144476-23144498 TGGGAGAGACAGGCTCAGGTAGG - Intronic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1157109659 18:44808684-44808706 AGGGGGAAACAAGCTCTGGAAGG - Intronic
1157155927 18:45266041-45266063 AAGGAGAATCAGGCTCACCAGGG + Intronic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158016311 18:52788731-52788753 TTGGAGGAACAGGGCCAGGAAGG + Intronic
1160162476 18:76484168-76484190 ATGGAGAAAAAGGCTAAGCTGGG + Intronic
1160451395 18:78968740-78968762 ACTGGGAAGCAGGCTCAGGAGGG - Intergenic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1161803313 19:6427587-6427609 AAGGAAAATGAGGCTCAGGAAGG + Intronic
1161872173 19:6878536-6878558 AAGGAGCCACAGGCTCAGGTTGG - Intergenic
1162403902 19:10462076-10462098 TGGGAGAAAGAGGCTGAGGAAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1163398704 19:17078852-17078874 ATACAGAAACAGGCCCAGGCAGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166288945 19:41849434-41849456 ATAGAAAAACAGGCTCAGAGAGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166770813 19:45280906-45280928 ATGCACAGCCAGGCTCAGGAAGG + Intronic
1166867676 19:45850527-45850549 AAAGGGAAACAGGCTCAGAATGG - Intronic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
925810381 2:7694362-7694384 ATGAGAAAACAGGCCCAGGAAGG + Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
927241224 2:20920950-20920972 ATGGAAAAATGTGCTCAGGAAGG - Intergenic
927845858 2:26472666-26472688 ATGGACAGACAGGCAGAGGAAGG + Intronic
928157189 2:28887633-28887655 ATGGAGGGACAGGGTCAGGGAGG - Intergenic
928309478 2:30197625-30197647 CTGGAGAAACTGGCTCAGGCAGG + Intergenic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
929046770 2:37798192-37798214 GTGGAGAAACAGGCACAGACAGG - Intergenic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929943034 2:46349275-46349297 ATGGACAGCCAGGCTCAGGAGGG - Intronic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931789814 2:65654745-65654767 TTGGAGAATCAGGCACAGGCTGG - Intergenic
932428967 2:71662074-71662096 ATGGGGAAACAGGCATGGGAGGG - Intronic
932443416 2:71754034-71754056 ATGGTGAAACAGCCTCAAGCAGG + Intergenic
932498313 2:72158619-72158641 ACGCAGAAACAGGGACAGGAAGG - Intergenic
932823830 2:74922790-74922812 ATGAGGAAACAGGCTCAAAAAGG + Intergenic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
935118548 2:100159412-100159434 AGGGAGAAATTGGATCAGGAGGG + Intergenic
935803450 2:106723260-106723282 AGGAAGAGAGAGGCTCAGGAAGG + Intergenic
936381837 2:111993217-111993239 ATTTAGAAACAGTCTCTGGATGG + Intronic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938371070 2:130768612-130768634 AGGGAAAAACAGGCTGAGGGTGG - Intergenic
938441578 2:131339580-131339602 AAGGAGCAAAAAGCTCAGGAAGG + Intronic
938792333 2:134687955-134687977 CTGGCAAAACAAGCTCAGGAAGG + Intronic
938943176 2:136187130-136187152 ATGGAGCAACTGGCTCAAGTAGG + Intergenic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
939712155 2:145535840-145535862 AGCAAGAAACAGGCTCTGGAGGG - Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941635410 2:167930492-167930514 ATACAGAAACAGGGCCAGGAAGG + Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943366209 2:186969859-186969881 AAGGAGAAACAAGCTGAAGAAGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
946928116 2:224645667-224645689 CTGGAGTGACAGGCTCAGGTGGG + Intergenic
947464379 2:230327902-230327924 AAGAAGAAAAAGGCCCAGGATGG + Intronic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947772489 2:232681809-232681831 ATGGAGATGCTGGCTCAGGGAGG - Exonic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
948880891 2:240856616-240856638 ATGCAGCAGCAGGCTCAGCATGG + Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170381804 20:15769022-15769044 ATTGTAAAACAGCCTCAGGAAGG - Intronic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172963148 20:38812916-38812938 ATGCAGAAACTGACTCAGTAGGG + Intronic
1173158589 20:40635859-40635881 ATGGACAGCCAGGCTCATGACGG - Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174145994 20:48453043-48453065 ACGCAGAAACAGGCCCAGAAAGG + Intergenic
1174170162 20:48612549-48612571 ATCGAGAAATATGCTAAGGAGGG - Intergenic
1174260661 20:49292561-49292583 ATAGCAAAACAGGCTCAGGGAGG + Intergenic
1174298469 20:49565734-49565756 AGGAGGAAACAGGCTCAGAAAGG - Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174514683 20:51082810-51082832 AAGGACAAACAGGCACAGGTGGG + Intergenic
1175401167 20:58700886-58700908 AGGGAGCACCAGGCTCAGGCAGG + Intronic
1175437202 20:58961845-58961867 ATGGAGTGACTGGTTCAGGATGG - Intergenic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175755207 20:61525300-61525322 CAGGAGAAAGAGGGTCAGGAGGG + Intronic
1175760059 20:61556348-61556370 ATGGAGAGAGAGGCTCCGGGGGG + Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176093951 20:63331048-63331070 ATGGCGAATCGGGTTCAGGAGGG + Intronic
1176261691 20:64185267-64185289 ATGGACAAGCTGGCTCAGCAGGG + Intronic
1176707655 21:10127522-10127544 GTGGACAAACAGGATCAAGATGG - Intergenic
1176843280 21:13857483-13857505 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176843768 21:13860968-13860990 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176846444 21:13880288-13880310 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1176848699 21:13896360-13896382 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1178330952 21:31690661-31690683 ATGGAGATACTGACACAGGAGGG + Intronic
1178442719 21:32612031-32612053 ATGGAGAAAGAGGGGCAGGGTGG - Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1179361631 21:40714584-40714606 ATGGTGAGACAGGAACAGGATGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179575379 21:42305244-42305266 ATGGAGAAACCAGGGCAGGAAGG - Intergenic
1180461124 22:15565787-15565809 AAGGAGCAAAAAGCTCAGGAAGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181631731 22:24155259-24155281 GATGAGAAACAGGCTCAGGAGGG - Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1182777194 22:32839837-32839859 AAGGAAACACAGGCTTAGGAAGG - Intronic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183487558 22:38097640-38097662 ATGGGGCCCCAGGCTCAGGAAGG + Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184088390 22:42279693-42279715 ATGAGCAAACAGGCTCAGGGAGG + Intronic
1184095470 22:42314081-42314103 AGGCAGATACAGGCTCAGCAGGG + Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1185073490 22:48669907-48669929 ATGGAGAAGCCAGCTCAGGCGGG - Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952845963 3:37688574-37688596 AGGCAGGACCAGGCTCAGGACGG - Intronic
952931674 3:38365599-38365621 ATGGAGAAACAGTCCTGGGAAGG - Exonic
953043865 3:39278364-39278386 AATGAGAAATGGGCTCAGGAAGG - Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
954460973 3:50626746-50626768 ATGCAGAGACAGGTTCAGAAAGG + Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
955362589 3:58288393-58288415 ATGCAGAAACCCTCTCAGGAAGG - Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956687061 3:71839892-71839914 ATAGAGAAACAGGCTTAGAGAGG + Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958627679 3:96646763-96646785 ATGGAGGAAGAGGCACAGGCGGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960038864 3:113129038-113129060 ATGGAGAAAAGGGCACAGGGAGG + Intergenic
960108650 3:113824131-113824153 ATAGAAAAACAGGCTTAGGCTGG - Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961884048 3:130084092-130084114 ATGGTGACTGAGGCTCAGGAGGG + Intronic
962451857 3:135525950-135525972 TCTGAGAAACAGGCTCAGAAAGG - Intergenic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962803708 3:138911947-138911969 CTGGAGAAACAGGCACATTAAGG - Intergenic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
965991166 3:174819934-174819956 ATGGAGAAATTGGATTAGGAAGG - Intronic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
967150078 3:186640435-186640457 GTGGAGAACAAGGCCCAGGATGG - Exonic
967789073 3:193527827-193527849 ATGGACAAACAGGCCCAGACAGG - Intronic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968631055 4:1651752-1651774 AGGGACACACAGGCTCAGCAAGG + Intronic
968729065 4:2261341-2261363 CTGGGGAAACAGGCTCAGCCAGG - Intronic
969176400 4:5402307-5402329 ATGGAGCCACAGGCACAGGCCGG + Intronic
969420535 4:7092145-7092167 ATTTAGAGACAGGCACAGGAGGG - Intergenic
969820728 4:9718199-9718221 GTGGTGAATGAGGCTCAGGAGGG - Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970697586 4:18696336-18696358 ATGGAGAGAGAGGCACTGGAAGG - Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972428408 4:38956794-38956816 ATGGGGAAGCAGGCGCAGTAGGG - Intergenic
972495828 4:39633573-39633595 CTGTAGAGACAGGCTCAGGTTGG - Intronic
972982875 4:44726581-44726603 ATGCAGATAAAGGCGCAGGAAGG + Exonic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973977631 4:56279108-56279130 ATGGGGAAACAGGCTCAAAGAGG + Intronic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
977172528 4:93780799-93780821 AGGGAGAAACAGGCTCTTAAAGG + Intergenic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
977589927 4:98814747-98814769 TTGGAGGAACAGGTCCAGGAAGG - Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
978884459 4:113750443-113750465 ATGCAGAAACAGGCTTGGGGAGG - Intronic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
982185402 4:152791974-152791996 ATGGATAAACAGGAACAGAATGG - Intronic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
982676562 4:158382732-158382754 ATGGAGAAACAAGGTAAGGCAGG + Intronic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
983961383 4:173759350-173759372 ATGGAAACTAAGGCTCAGGAAGG - Intergenic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987431094 5:17834125-17834147 ATGGAGAAACATGCTATGAATGG - Intergenic
987587472 5:19874860-19874882 ATTTAGAAAAATGCTCAGGATGG + Intronic
988493586 5:31726105-31726127 AAGGAAAGGCAGGCTCAGGACGG - Intronic
988949760 5:36244284-36244306 ATGCAGAAGTAGTCTCAGGAAGG - Intergenic
989625207 5:43423230-43423252 ATAGAAAAACAGGCTATGGATGG + Intergenic
990352843 5:54936087-54936109 AGGGAGAATGAGACTCAGGAAGG - Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
991009345 5:61866795-61866817 ATGGAGAAATAGACTCTTGATGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
994516724 5:100781854-100781876 ATGTAGAAATTGGCTCATGATGG + Intergenic
994603545 5:101938732-101938754 ATGGATAAACAGTCTTAGTAAGG - Intergenic
995558106 5:113351505-113351527 ATGGAGATAGAGGATAAGGATGG + Intronic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
996291948 5:121861663-121861685 AAGGAGAAAGAGGGTAAGGATGG + Intergenic
996439805 5:123477477-123477499 ATCGAGAAACAGGCCAAGAAGGG - Intergenic
996681152 5:126229098-126229120 GTGGAGGAACAGGCACAGGCAGG + Intergenic
997712177 5:136015187-136015209 AGGCAGAGACAGGCTCAGGGAGG - Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998131797 5:139655192-139655214 ATGGAGGGACAGGCTGAGGGTGG - Intronic
998152756 5:139766398-139766420 ACTGAGAAACAGGCCCAGGCAGG - Intergenic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998337222 5:141383848-141383870 ATGGAGGTTCAGGCTCAAGATGG + Exonic
998742586 5:145221780-145221802 ATGGAGAAACAAGCACAGAGAGG - Intergenic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
1000017929 5:157294755-157294777 ATGGTAAAACAGCCTCAGCAGGG - Intronic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1001137762 5:169116718-169116740 AGGGAGAAACAGGCTAATCAGGG + Intronic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1001741022 5:174052725-174052747 GTGCAGAAACAGGCTCAGACAGG + Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1005286302 6:24330729-24330751 ATGGAGAAACAGGATCCACAGGG + Intronic
1006379573 6:33689639-33689661 TTGGAGCAACAGGGTCAGGGTGG + Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007694729 6:43724998-43725020 GTGGGGAAACAGGCTCAGAGAGG + Intergenic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008584324 6:52935169-52935191 ATGGAGCTACAGGGTTAGGAGGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008979736 6:57469190-57469212 AGGGAAACTCAGGCTCAGGATGG - Intronic
1009313701 6:62190403-62190425 ATTTAGAAAAAGGTTCAGGAAGG - Intronic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1010509200 6:76697046-76697068 ATGCAGAAATAGGGTCAGGGAGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1012851488 6:104451784-104451806 ATGGATGGACAGGCTCAAGAGGG + Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1013648831 6:112172815-112172837 ATGGAGATAAAGGCTCAGTGTGG + Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1016581063 6:145629740-145629762 CTGGAGAGACAGGCACAGCAGGG - Intronic
1017955758 6:159176507-159176529 TTGGAGAAAGATGCTGAGGAAGG + Intronic
1018467765 6:164066989-164067011 TTTCAGAGACAGGCTCAGGAAGG + Intergenic
1019335802 7:481962-481984 GTTGAGGCACAGGCTCAGGAAGG - Intergenic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020070414 7:5223571-5223593 GGGCAGAAACAGGCACAGGAGGG - Intronic
1020204219 7:6103093-6103115 AGGGAGAAGCAGGCTCATGGTGG + Intergenic
1020978468 7:15038004-15038026 ATGGATTAAAAGGCTCAGGAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1023127133 7:36965468-36965490 CTGGAGAAAATGGCTCAGTAAGG + Intronic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1023749529 7:43358444-43358466 ATCGAGAAAGTGACTCAGGAAGG + Intronic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1025834932 7:65085561-65085583 ATGGGGAAACGGGCTCAGAGAGG - Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1027353651 7:77336381-77336403 ATTGAGGAACAGACCCAGGATGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029843202 7:103387588-103387610 ATGCAGAAACAGGCTCTGAGAGG + Intronic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033253155 7:139777709-139777731 GCGGAGACACAGGCTCAAGATGG - Exonic
1033280755 7:140004845-140004867 ATCGAGAAACAGCCTCCGGCCGG + Intronic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034339958 7:150346539-150346561 AGGGAGAGAGAGACTCAGGAGGG + Intergenic
1034892986 7:154857089-154857111 ATGCAGAAACAGGCTAGGGCGGG - Intronic
1035050236 7:155994533-155994555 AGGCAGACAGAGGCTCAGGAGGG - Intergenic
1035080361 7:156210517-156210539 ATGGAGAAAGCTGCCCAGGATGG - Intergenic
1035705499 8:1671499-1671521 ATGGAGAGACAGCTCCAGGAGGG + Intronic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1036619653 8:10416077-10416099 CTGGGGAAGCAGGCTCAGGCAGG - Intronic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037122524 8:15306053-15306075 TGGAAGGAACAGGCTCAGGAGGG - Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038413683 8:27377587-27377609 AAGGAGACACTGGCTCAGAAAGG - Intronic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1039582770 8:38680582-38680604 ATGGAGAAAGACGTTAAGGAAGG + Intergenic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1039952550 8:42183297-42183319 AGGGGGAAAAAGGCTCAGGCCGG - Intronic
1040526460 8:48229469-48229491 TTGGAGAAACAGGGCCAGGCAGG - Intergenic
1041345018 8:56888363-56888385 ATGGAGAAAGAGGTCCATGAAGG - Intergenic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044857701 8:96493670-96493692 CCGGAGAAGCAGGCTCAGGAGGG + Exonic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045061810 8:98417629-98417651 AGGGGGAAACAGGCACAGAAAGG - Intronic
1045429857 8:102103424-102103446 TTAGAGATAAAGGCTCAGGAGGG + Intronic
1045931552 8:107633097-107633119 CTGGAGAAGCAGGCCCTGGAGGG + Intergenic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1048302595 8:133262501-133262523 ATGGAAAGAGAGGATCAGGAGGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048747728 8:137633637-137633659 ATGGAGATACAGGCACTGAAAGG - Intergenic
1048971443 8:139647168-139647190 AGGGTGGAACAGGCCCAGGATGG + Intronic
1049017885 8:139934005-139934027 ATGGAGAAATATGGACAGGATGG - Intronic
1049302352 8:141878343-141878365 GTGGGGAATCAGGCCCAGGAAGG + Intergenic
1049414620 8:142489581-142489603 GTGGGGAAACAGGCTCAGAGAGG + Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1053496110 9:38549293-38549315 ATGTAGAAGCAGGTTCAGAAGGG - Intronic
1053665650 9:40315683-40315705 ATGTAGAAGCAGGTTCAGAAGGG + Intronic
1053761133 9:41350592-41350614 GTGGACAAACAGGATCAAGATGG + Intergenic
1053915233 9:42940730-42940752 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054325870 9:63712139-63712161 GTGGACAAACAGGATCAAGATGG - Intergenic
1054376806 9:64455713-64455735 ATGTAGAAGCAGGTTCAGAAGGG + Intergenic
1054518964 9:66060601-66060623 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1056693254 9:88825750-88825772 ACGGTGAAACAGGCATAGGACGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057187438 9:93064809-93064831 GTGGAGACACAGGCCCAGGGTGG + Intronic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1057676033 9:97136811-97136833 ATGTAGAAGCAGGTTCAGAAGGG - Intergenic
1057900970 9:98947959-98947981 ATGGGAAAACAGGCTCAGAGTGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059104488 9:111500037-111500059 GTGGAGGAACAGTCTCAGGGTGG + Intergenic
1059256369 9:112934869-112934891 AAAGAGAAACAGTCCCAGGAAGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059433179 9:114261843-114261865 GGACAGAAACAGGCTCAGGATGG - Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060391549 9:123281766-123281788 ATAGAGAAACAGACTCAGTGGGG + Intergenic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1060987284 9:127826964-127826986 AGGGAGAGACAGCCGCAGGATGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061799111 9:133104477-133104499 AGGGGGAGGCAGGCTCAGGAAGG - Intronic
1061937620 9:133866992-133867014 TTGAGGAAACAGGCTCAGGGAGG - Intronic
1062519739 9:136952664-136952686 GAGGGGAAACAGGCTCGGGAAGG + Intronic
1202792400 9_KI270719v1_random:96402-96424 GTGGACAAACAGGATCAAGATGG - Intergenic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1186511136 X:10130482-10130504 AGGGACAAAGAGGCTCTGGAGGG + Intronic
1186612133 X:11148048-11148070 GTGGAGAAATGGGCCCAGGAGGG + Intronic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1189258077 X:39655678-39655700 ATGGAAAGATAGGCGCAGGAAGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192538113 X:71945901-71945923 TTGGGGAAACAGGCTCAGAGGGG + Intergenic
1192862841 X:75096607-75096629 AATGTGAAACAAGCTCAGGAAGG - Intronic
1195009116 X:100718001-100718023 ATGGGGAAACAGACTCAAGGAGG - Intronic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195379539 X:104257264-104257286 ATGGAGGAAGGGGCCCAGGAAGG - Intergenic
1195385151 X:104307004-104307026 ATGGGAAAACAGGCTCAGAGTGG - Intergenic
1195510492 X:105710737-105710759 ATTTAGAAACAGGCTCAGATAGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197067284 X:122248499-122248521 TTGGACAAACAGGCTAAGCATGG - Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1198506914 X:137310078-137310100 CAGGTGAAACAGGCTCAGGGAGG - Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1199967599 X:152832751-152832773 AATGAGAAACAGGCTCAGAGAGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1201175462 Y:11306471-11306493 AGGGAGAAACCGGCTTGGGAGGG - Intergenic
1201722797 Y:17120099-17120121 ATGGATAAACAGTCTCAATAGGG - Intergenic