ID: 1119477297

View in Genome Browser
Species Human (GRCh38)
Location 14:74938389-74938411
Sequence CATGGTGACCTCAGGGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119477290_1119477297 14 Left 1119477290 14:74938352-74938374 CCACATCTCTATACGGCCAGCTT No data
Right 1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG No data
1119477291_1119477297 -2 Left 1119477291 14:74938368-74938390 CCAGCTTGAGCTTCCTTCCAACA No data
Right 1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119477297 Original CRISPR CATGGTGACCTCAGGGTAGT TGG Intergenic
No off target data available for this crispr