ID: 1119478123

View in Genome Browser
Species Human (GRCh38)
Location 14:74942792-74942814
Sequence CCTCCTATGGAGGAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119478111_1119478123 25 Left 1119478111 14:74942744-74942766 CCAAGCACAGACGGGGCGGGTAT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1119478123 14:74942792-74942814 CCTCCTATGGAGGAGGGGGCAGG 0: 1
1: 0
2: 1
3: 36
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119478123 Original CRISPR CCTCCTATGGAGGAGGGGGC AGG Intronic
901198517 1:7453704-7453726 CCTCCTACTGAGGAGAGAGCAGG - Intronic
901643430 1:10704559-10704581 CCTCCTGGGGGGAAGGGGGCCGG + Intronic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
903078028 1:20787076-20787098 GCTCCCAGAGAGGAGGGGGCGGG - Intronic
904496279 1:30888627-30888649 CCTCCTCAGGAGGAGAGGCCTGG - Intronic
904976081 1:34457667-34457689 CCTACTCTGGAGGCTGGGGCAGG + Intergenic
905205129 1:36339132-36339154 CTTCCTATTGAGGAGAGGGAGGG + Intergenic
905828837 1:41048021-41048043 CCTGCTAGGGAGGAGGGGCAGGG + Intronic
906106990 1:43300666-43300688 CCGCCTATTGAGGAGGGGGGTGG - Intergenic
906332743 1:44901225-44901247 CCTCCTATGGAGGCTGAGGCAGG - Intronic
908527400 1:65001343-65001365 CCTCCTGCGGAGCTGGGGGCGGG + Intergenic
913074220 1:115327811-115327833 CCTGCTTGGGAGGTGGGGGCAGG + Intronic
913387769 1:118278296-118278318 TCTCCTGTGGAGGAGTGGGATGG + Intergenic
913962849 1:143353217-143353239 GCTCCTTTGGGGGAGGGTGCGGG + Intergenic
914057204 1:144178802-144178824 GCTCCTTTGGGGGAGGGTGCGGG + Intergenic
914121942 1:144787564-144787586 GCTCCTTTGGGGGAGGGTGCGGG - Intergenic
914346120 1:146799743-146799765 CCTCTTCTGGCGGAGGTGGCAGG - Intergenic
916033641 1:160901603-160901625 CCTCCAAAGGAGAAGGGTGCAGG - Intergenic
916179425 1:162070568-162070590 TCTCCTCTGGAGGAGGGATCCGG - Intronic
917497088 1:175550330-175550352 CCTCCTGTGGAGGTGAGGGTTGG - Intronic
917610638 1:176685669-176685691 CCTGGTGGGGAGGAGGGGGCCGG - Intronic
917968007 1:180190634-180190656 CCTCCAAGGGGAGAGGGGGCAGG + Intronic
919201021 1:194355923-194355945 GCTGCTCTGGAGGCGGGGGCAGG - Intergenic
919281552 1:195495936-195495958 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
919344823 1:196361988-196362010 CCACCTAAGGAGGAGGGTGATGG + Intronic
919785013 1:201253340-201253362 CCTCCCATAGAGGAGGGGAGAGG - Intergenic
919940640 1:202283638-202283660 CCACCTGGGGAGGAGGGGCCAGG + Intronic
920195152 1:204221852-204221874 CCTCCTAGGGATGAGGTGGGAGG + Exonic
920211664 1:204332996-204333018 CCACCTAGGGAGGAGGAGGCAGG + Intronic
920966450 1:210705222-210705244 CCTCCTCTGGAGAAGCTGGCAGG - Intronic
921788515 1:219262720-219262742 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
922824814 1:228510425-228510447 CCTTTCAGGGAGGAGGGGGCTGG + Intergenic
923018052 1:230142149-230142171 CCTCCTGTGGAGGTGGGGGGAGG + Intronic
923122319 1:231003214-231003236 CCTGCTCTGGTGGAGGAGGCAGG - Intergenic
924310072 1:242731830-242731852 ACTCCAGTGGAGGTGGGGGCTGG - Intergenic
924758572 1:246964080-246964102 CCAGGTATGGGGGAGGGGGCAGG + Intronic
1062909887 10:1205624-1205646 CCTCCCATGGTGGAAGGGGCTGG - Intronic
1063112936 10:3052653-3052675 CCTAATATGGGGGAGGAGGCGGG + Intergenic
1063348525 10:5334208-5334230 CCTCCTATGGAAGGGGGGTTGGG + Intergenic
1067086057 10:43238769-43238791 CTTCCCATGGAAGAGGGGGCAGG - Intronic
1067158562 10:43803151-43803173 CCTCACATGGAGCAAGGGGCCGG + Intergenic
1067441872 10:46313093-46313115 CCCCCTCTGGGGGAGGGGCCTGG - Intronic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1067776042 10:49165588-49165610 CCTCCTCTGGACCAGTGGGCAGG - Intronic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1071870509 10:89789391-89789413 CCACCTACGGTGGAGGTGGCAGG + Intergenic
1072764110 10:98082159-98082181 CCTGCTAGAGAGGAGAGGGCAGG - Intergenic
1075070746 10:119318539-119318561 TGTCCTTTGGAGGAGGGGGCTGG + Intronic
1075710410 10:124527645-124527667 CCCCCTCTGGAGGGTGGGGCTGG - Intronic
1076369146 10:129940686-129940708 CCTGCTAGGAAGTAGGGGGCTGG + Intronic
1076894322 10:133302453-133302475 CCACCTCTGGTGCAGGGGGCAGG - Intronic
1077299742 11:1841437-1841459 GCTCCTGTGGAGGAGAGGGCAGG - Exonic
1077917922 11:6623009-6623031 CCACCTCTGGGGGTGGGGGCCGG - Exonic
1078588044 11:12610957-12610979 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1079464117 11:20712862-20712884 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1079952115 11:26818902-26818924 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1080869355 11:36223807-36223829 CCACCTCTGGGGGATGGGGCTGG - Intronic
1081587955 11:44400304-44400326 CCTCCTTTGGGGGAGGAGGGAGG + Intergenic
1083726251 11:64630150-64630172 CCCCCTATGGGGGAGGGTGCAGG - Intronic
1085199247 11:74691814-74691836 ACTCTGATGGAGGAGGTGGCAGG + Intergenic
1085231196 11:74972454-74972476 CACACTTTGGAGGAGGGGGCGGG - Intronic
1085641891 11:78197919-78197941 CCTCCTCTGGAACAGGGGACAGG - Exonic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1089292296 11:117444545-117444567 CCGTCCAGGGAGGAGGGGGCGGG + Intronic
1089703431 11:120259651-120259673 ACTCCTAAGAAGGAGGTGGCAGG + Intronic
1090363730 11:126189948-126189970 CCTCCTAGGGAGGGAGGGGTGGG - Intergenic
1090756765 11:129798546-129798568 CCTTCTCTGGTGGAGGTGGCAGG - Intergenic
1090932418 11:131310125-131310147 CCACCTGTGGAGGAGGGGAAGGG - Intergenic
1091060556 11:132457518-132457540 CCTTCTATGGAGGAGGCAGGTGG + Intronic
1091776255 12:3186824-3186846 ACTCCTGGGGAGGAGGGGGCAGG + Intronic
1092140777 12:6182076-6182098 CCTCCGCTGGAGGAAGGGACAGG + Intergenic
1092533332 12:9363425-9363447 CCTGCTGTGGAGGAGGAGGGTGG - Intergenic
1092793151 12:12086801-12086823 CCTCCTATGCATGTAGGGGCTGG + Intronic
1093104935 12:15075000-15075022 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1093214126 12:16343260-16343282 CCTCACATGACGGAGGGGGCAGG - Intergenic
1093488681 12:19681063-19681085 CCTCTTCTGGTGGAGGTGGCAGG + Intronic
1093502448 12:19828082-19828104 GCTCCTAGGCAGGAAGGGGCAGG - Intergenic
1093547680 12:20368242-20368264 CCTCCTCCGCAGGAGGGGGCGGG + Intergenic
1093705815 12:22273963-22273985 TTTCCTGGGGAGGAGGGGGCTGG - Intronic
1094721974 12:33075064-33075086 CCTGCTATGGTGGAAGTGGCAGG + Intergenic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1096086080 12:48865862-48865884 CCTCCAACTGAGGAGGAGGCCGG + Exonic
1096412387 12:51386707-51386729 CATCATATTGGGGAGGGGGCAGG + Intronic
1097294772 12:57950486-57950508 CCTACTCTGGAGGTGGGGGAAGG - Intronic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1097990003 12:65824572-65824594 CCTCCTAGGGTGGCGGGAGCAGG - Exonic
1100203547 12:92325136-92325158 CCTGTTATGGTGGAGGTGGCAGG + Intergenic
1101051556 12:100868985-100869007 CATCCTGTGGAGAAGGGGGTTGG - Intronic
1102027214 12:109720340-109720362 CCTCCCTTGGAGGAGGAGGGAGG + Intronic
1102430169 12:112876805-112876827 CCTCCTCTGGGGGTGGTGGCTGG - Exonic
1102544035 12:113641827-113641849 CCCGCTAGGGAGGAGGGGGTGGG - Intergenic
1103271768 12:119679631-119679653 CCTCTTATGGAGGGTGGGGCAGG - Intronic
1103446305 12:120997356-120997378 CGTGGTTTGGAGGAGGGGGCAGG - Intronic
1104022601 12:125003346-125003368 CCTCCCATGGAGGCGATGGCTGG + Intronic
1104437111 12:128765298-128765320 CCTTCAGTGGAGGAGGGGGCAGG + Intergenic
1104894044 12:132153251-132153273 CCTCCCACGGGGGTGGGGGCAGG - Intergenic
1107361224 13:39619412-39619434 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1108739684 13:53322947-53322969 CCTCCTAGGGAAGAGGGAGGAGG - Intergenic
1111834461 13:93370629-93370651 CCTGTTATGGAGGAAGAGGCTGG + Intronic
1113240304 13:108329228-108329250 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1113534913 13:111058465-111058487 CCTGCTCTGGTGGAGGGAGCAGG + Intergenic
1113707787 13:112445566-112445588 CCCCCCATGGAGGGGGCGGCAGG + Intergenic
1116130831 14:40854470-40854492 AGTCCTATGCAGAAGGGGGCAGG + Intergenic
1117638731 14:57774751-57774773 GCTGCAATGGAGGAGGGAGCAGG - Intronic
1118293808 14:64550143-64550165 CCGCCTCTGGAGGAGGGCGAGGG - Intronic
1118708867 14:68503421-68503443 CAGCCTCTGGAGGAGGGGGAAGG - Intronic
1119478123 14:74942792-74942814 CCTCCTATGGAGGAGGGGGCAGG + Intronic
1119882695 14:78113688-78113710 CCCCCACTGGAGGAGGGAGCTGG - Intergenic
1120855210 14:89205993-89206015 CCTCCCATAGTGGAGGGGACGGG - Intronic
1121327931 14:93032625-93032647 CCTCCCATTGAGGGTGGGGCAGG - Intronic
1121410243 14:93744427-93744449 CCTCCTATGGCGGCTGGGGGAGG + Intronic
1121492905 14:94372532-94372554 CCTCCTGAGGGGGAGGGGGAGGG + Intergenic
1122060968 14:99136470-99136492 ATTCCTCTGGAGGAGGGAGCAGG - Intergenic
1122318443 14:100839360-100839382 CCTCCTTTGGAAGAGGGGACAGG - Intergenic
1122328398 14:100896631-100896653 CCTCCTCTGGATGTGGGGGTGGG + Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1124373309 15:29115535-29115557 CCACCCGTGGAGGAGCGGGCGGG + Intronic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1124577563 15:30923238-30923260 CCTCTCATGGAGGAGGGTGTGGG + Intronic
1128183307 15:65623791-65623813 TTTCCTCTGGAGCAGGGGGCAGG + Intronic
1128220979 15:65968401-65968423 CCTGCTAAGCAGGAGGGAGCAGG - Intronic
1128272785 15:66326284-66326306 CCTGGTGTGGAGGAGGGTGCTGG - Exonic
1128709442 15:69860731-69860753 CATCCTATAGAGGAGGAGACCGG - Intergenic
1129462165 15:75704921-75704943 CCCTCTCTGGAGGTGGGGGCTGG - Intronic
1129722692 15:77886925-77886947 CCCTCTCTGGAGGTGGGGGCTGG + Intergenic
1130102566 15:80905085-80905107 CTTCCTGTGGAGGAGAGAGCAGG + Intronic
1131036081 15:89222839-89222861 CCTGCTCTGGAGGAAGGGGTCGG - Intergenic
1131098621 15:89671411-89671433 CCTCTCAGGGAGGAGAGGGCAGG - Intronic
1131676109 15:94672348-94672370 GCTTCTAGGGAGGAGGGGGTAGG + Intergenic
1132382216 15:101374190-101374212 CCTCCTCAGGAGAAGGGAGCGGG - Intronic
1132466018 16:77826-77848 CGTGCTTTGGGGGAGGGGGCGGG - Intronic
1132885474 16:2180314-2180336 CCTCCATTGGGGGTGGGGGCCGG - Exonic
1133138629 16:3729178-3729200 CCACCGCTGCAGGAGGGGGCTGG + Exonic
1133140132 16:3737569-3737591 GCTCCTCAGGAGGTGGGGGCAGG - Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1136498997 16:30660244-30660266 CCTTCTGTGGAGGAGGAGGTGGG - Exonic
1136567088 16:31077008-31077030 CCTCCTCAGCAGGAGGGGACTGG - Exonic
1136608495 16:31352453-31352475 CCACCTCTGGCGGAGGAGGCAGG - Intergenic
1137612569 16:49828794-49828816 CCGGCTATGGAGGAGAGGTCTGG + Intronic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138694352 16:58797866-58797888 CCTCATATGGTGGAAGGGGCAGG + Intergenic
1139587232 16:67911808-67911830 CCTCCTGCTGGGGAGGGGGCTGG + Intronic
1139987859 16:70915524-70915546 CCTCTTCTGGCGGAGGTGGCAGG + Intronic
1141716235 16:85728649-85728671 CCTGCTATGGAGGTGGCTGCAGG - Intronic
1142027592 16:87822865-87822887 CCTCCTACCGAGGAGGGGGTGGG + Intergenic
1142833873 17:2569991-2570013 CCTACTATGGAGGCTGAGGCAGG + Intergenic
1142978134 17:3657175-3657197 GTTCCTATGGAGGAGGGGAGGGG + Intronic
1143513347 17:7407607-7407629 CCTCCCAGGGAGGTGGGAGCTGG + Intronic
1144590339 17:16518384-16518406 TCTCCTTTGGGGAAGGGGGCAGG + Intergenic
1144791552 17:17862394-17862416 TCTCCTGTGGATGAGGGGCCAGG + Intronic
1145036039 17:19541300-19541322 TCTCCTAGGGAGCAGGGGTCAGG + Intronic
1145299417 17:21621539-21621561 GCTACTATGGAGGATGAGGCAGG - Intergenic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1146890041 17:36501000-36501022 TCTCCTCAGCAGGAGGGGGCAGG - Intronic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1150338099 17:64344579-64344601 CCTCCTATGGAGGAGGGGTTGGG - Intronic
1151280688 17:73072153-73072175 GTTCCTATGAAGGAGAGGGCGGG - Intronic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1152779479 17:82219909-82219931 CCTCCTCTTGAGCTGGGGGCTGG - Intergenic
1153457252 18:5295358-5295380 CCGCCGGCGGAGGAGGGGGCCGG - Intronic
1154297931 18:13166281-13166303 CCTGCTGTGGTGGAGGTGGCAGG - Intergenic
1155738705 18:29258111-29258133 CCTTCTATGGTGGAGGGGACTGG - Intergenic
1156020967 18:32598561-32598583 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1156503104 18:37572202-37572224 CCTCCTTTGTAGGAGGTGGGAGG - Intergenic
1156893314 18:42215211-42215233 CCTCCTCTGGTGGAGGTGGCAGG + Intergenic
1157366163 18:47066031-47066053 CCTCCTATGGTGGAGGGAACTGG + Intronic
1159453994 18:68638293-68638315 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1159612849 18:70545959-70545981 CCTGCTCTGGTGGAGGCGGCAGG + Intergenic
1160868439 19:1266425-1266447 CCTCCTAGCCAGGCGGGGGCCGG - Intronic
1161424943 19:4198288-4198310 CATCCCGTGGGGGAGGGGGCTGG + Intronic
1161994611 19:7704542-7704564 CCTCCCAACCAGGAGGGGGCTGG - Intergenic
1162126537 19:8502469-8502491 CCACCTGTGGAGGGGCGGGCGGG - Intronic
1162850217 19:13425363-13425385 CCTCCTAGGGAGCAGGGGTGGGG + Intronic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164741689 19:30580584-30580606 CCTCCTTTGGAAGAGGGGCTGGG - Intronic
1164826087 19:31285904-31285926 GCTCCCATGGAGGAGGCAGCTGG + Intronic
1165313499 19:35041703-35041725 TCACCTGAGGAGGAGGGGGCTGG - Exonic
1165396924 19:35569555-35569577 CCTCCCAGGGTCGAGGGGGCGGG - Intergenic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1165792329 19:38499831-38499853 TGCCCTATTGAGGAGGGGGCCGG - Intronic
1166102047 19:40576830-40576852 CAGCCTATGGAGGCGGGGTCCGG + Exonic
1166298772 19:41902682-41902704 CTTCCCAGGGAGGAGGGGCCTGG + Intronic
1166422969 19:42652826-42652848 CCTCCTAGGGTGCAGAGGGCAGG - Intronic
1166679141 19:44756761-44756783 CCTCCTAGTGAGGAGGGAGGGGG + Intronic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167079322 19:47268510-47268532 CTTCCTAAGGAGGAGGCAGCTGG + Intronic
1167382366 19:49146045-49146067 CCTTCTTTGGGGGTGGGGGCGGG + Intronic
1167460373 19:49621382-49621404 GGTCCGAAGGAGGAGGGGGCTGG + Intronic
1167708875 19:51098377-51098399 GCTCTGAGGGAGGAGGGGGCTGG - Exonic
1167781565 19:51601907-51601929 GCTCTGAGGGAGGAGGGGGCTGG + Intergenic
1167800151 19:51735388-51735410 CCTCACATGGTGGTGGGGGCAGG + Intergenic
1168233686 19:55048758-55048780 CCTCCTCTGGAAGAGAGGGGTGG + Exonic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
1202696687 1_KI270712v1_random:131475-131497 GCTCCTTTGGGGGAGGGTGCGGG + Intergenic
926165347 2:10519349-10519371 CCTTCTAGGGAGGAAGGAGCAGG + Intergenic
926332137 2:11834422-11834444 CCTAATATGGGGGCGGGGGCTGG - Intergenic
927203219 2:20591226-20591248 GCTCCCGTGGAGGAAGGGGCTGG - Intronic
927606557 2:24491471-24491493 CCTGCTCCGGAGGAGGGGGCCGG + Intergenic
929107784 2:38380914-38380936 CTTCCTTTGGGGGAGGGGCCAGG + Intergenic
930159968 2:48144790-48144812 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
932493075 2:72133744-72133766 CCTGCGATGGAGGAAGGGGCTGG - Intronic
932544457 2:72693142-72693164 CCTTCTTTGGATGTGGGGGCAGG - Intronic
932639767 2:73432600-73432622 CCTCCCATGGTGGAAGGGGCAGG + Intronic
934277840 2:91588489-91588511 GCTCCTTTGGGGGAGGGTGCGGG + Intergenic
934735035 2:96685779-96685801 CTTCCTATGGAGCAGTGGGAAGG + Intergenic
935007179 2:99090018-99090040 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
936232137 2:110712287-110712309 CCTCCTAGTGAGAAGGGGGAAGG - Intergenic
936515918 2:113181587-113181609 CCTTCTAGGGAGGAAGAGGCTGG - Intronic
937410494 2:121670581-121670603 CCTCCTCTGGGGGAGGTGGCAGG - Intergenic
937633574 2:124130411-124130433 GCTTGGATGGAGGAGGGGGCAGG - Intronic
938714799 2:134009692-134009714 ACTCCTATGCAAGAGGAGGCAGG - Intergenic
938776387 2:134544978-134545000 CCTCCCCTCCAGGAGGGGGCTGG - Intronic
939219398 2:139282025-139282047 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
939955412 2:148523810-148523832 CCTCCTATGGAAAATGGGGTGGG - Intergenic
940172316 2:150842749-150842771 CCTGTTCTGGAGGAGGTGGCAGG + Intergenic
940784928 2:157971373-157971395 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
941718302 2:168786837-168786859 GCTACTCTGGAGGAGGGGGGAGG - Intronic
943046710 2:182868567-182868589 CCACTTATGGTGGCGGGGGCGGG + Intergenic
943705004 2:191025330-191025352 CCACTTATGGAGGAAGGGGAAGG - Intergenic
945536479 2:211024756-211024778 CCTCCTCTGGTGGAAGTGGCAGG + Intergenic
946109640 2:217403279-217403301 AGTCATATGGAGGTGGGGGCAGG + Intronic
946176046 2:217922518-217922540 CCTCCTGTGAGGGAGGGGACTGG - Intronic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1170865377 20:20150660-20150682 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1172015590 20:31870693-31870715 CCACCTCCGGAGGTGGGGGCGGG + Exonic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1173132974 20:40411799-40411821 CCTCCCATTGAGGATGGAGCAGG - Intergenic
1173801086 20:45894922-45894944 CCTCCTGGTGAGGTGGGGGCAGG + Intronic
1173982931 20:47238973-47238995 CTTCCTGTGGCGGCGGGGGCCGG + Exonic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174637152 20:52010881-52010903 CCTCCTATGGAGGAAAGGCAGGG + Intergenic
1174994893 20:55555352-55555374 CCTTCTATGGGGGAAGGGGAAGG - Intergenic
1175360563 20:58408035-58408057 CCACCCATGGAGGTGGTGGCAGG + Intronic
1175720325 20:61281741-61281763 CCTCCAGGGGAGGAGGTGGCGGG - Intronic
1175928580 20:62482606-62482628 CCTCCTTAGGATGTGGGGGCGGG + Intergenic
1176658631 21:9613104-9613126 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1178369614 21:32016642-32016664 CCTTCTAAGGAGGTGGGGGTGGG + Intronic
1179565609 21:42246001-42246023 CATCCTAGAGAGGTGGGGGCAGG + Intronic
1179710435 21:43210168-43210190 CCTCCTCTGGAAGATGGAGCAGG - Intergenic
1180955290 22:19738677-19738699 CCTGCTTTGGAGGAGGGGGTGGG - Intergenic
1181419333 22:22786907-22786929 CCTCTTGGGGAGGAGGGGGGAGG - Intronic
1181880286 22:25973788-25973810 CTCCCTAGGGTGGAGGGGGCTGG + Intronic
1184286322 22:43473694-43473716 TCTCAGATGGAGTAGGGGGCAGG + Intronic
1184444184 22:44537726-44537748 CATCCCCTGGAGGAGTGGGCGGG - Intergenic
1184678881 22:46059050-46059072 CTTCCCATGCAGGAGAGGGCTGG + Intronic
1184724009 22:46332497-46332519 CATCCTATGGAGAAAGGGGCTGG - Intronic
1185264938 22:49896381-49896403 CCTCCTATTGAGGTGGGTGAGGG + Intergenic
950584621 3:13883441-13883463 CATCTAATGGAGGAGGGGGAAGG + Intergenic
950978834 3:17280174-17280196 CCTACTATAGAGATGGGGGCAGG + Intronic
953276773 3:41508577-41508599 CCTCCTCTGGTGGAGGTAGCAGG - Intronic
953899943 3:46834165-46834187 CCTGCGAGGGACGAGGGGGCAGG + Intergenic
954916913 3:54156342-54156364 CCACCCACGGAGGAGGGAGCTGG + Intronic
955327553 3:58020960-58020982 CCTCCTAGGGAGGCCGGGGCAGG + Intronic
955916277 3:63911944-63911966 CCACCTATGGAGGAGCCGGCCGG - Intronic
956191446 3:66612044-66612066 CCTCAGGTGGAAGAGGGGGCAGG + Intergenic
956747529 3:72321416-72321438 CCTCCCATGGAGGCTGGGGTAGG + Intergenic
957392764 3:79599013-79599035 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
957434307 3:80153969-80153991 CCTCTTTTGGAGGTGGGGCCTGG + Intergenic
959062211 3:101625995-101626017 CCTCCTGGGGAGGTAGGGGCTGG - Intergenic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
961381105 3:126497095-126497117 TCACCTGTGGAGGAGGAGGCGGG - Intronic
961394990 3:126580415-126580437 CCTGCTCAGAAGGAGGGGGCCGG + Intronic
962191917 3:133319633-133319655 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
962235019 3:133700217-133700239 CATCCTAAGGAGGTGGGGGGTGG + Intergenic
962351077 3:134656170-134656192 CCTCCCAGAGAGGAGGGGCCAGG + Intronic
963050999 3:141143503-141143525 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
967887026 3:194340502-194340524 CCTCGTGTGGAGGTGGGTGCCGG + Exonic
968474187 4:795430-795452 CCTCCTCTGGAAACGGGGGCGGG - Intronic
969032904 4:4227846-4227868 GCTCCTTTGGGGGAGGGTGCGGG - Intergenic
970154806 4:13131010-13131032 ACTCCTGGGGAGGAGGTGGCGGG + Intergenic
970652673 4:18195829-18195851 ACTCCTATGGAGGAGGAGCAGGG - Intergenic
970856216 4:20651712-20651734 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
972097274 4:35364131-35364153 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
972661293 4:41119025-41119047 GCTACTCAGGAGGAGGGGGCAGG + Intronic
972671602 4:41217260-41217282 CCTCCTAGGGAGTTGGGGGAAGG + Intergenic
973037447 4:45423821-45423843 CCTGCTGTGGTGGAGGTGGCAGG + Intergenic
974801770 4:66827851-66827873 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
975243746 4:72094217-72094239 CCTCCTCCGGTGGAGGCGGCAGG + Intronic
975944961 4:79695380-79695402 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
976963059 4:91003133-91003155 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
978405130 4:108371114-108371136 GCTCCTAGGGAGGAGGGAGAGGG - Intergenic
978617850 4:110613862-110613884 CCTCCCTTTGGGGAGGGGGCAGG + Intergenic
979263503 4:118674874-118674896 CCTCCTCTTGAGGAGAGGGGTGG - Intergenic
981077069 4:140602632-140602654 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
981240563 4:142471849-142471871 TATACTATGGAGGAAGGGGCTGG - Intronic
983133582 4:164052418-164052440 CCTACTATGGAGGCTGAGGCAGG + Intronic
983894498 4:173067846-173067868 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
985288608 4:188362973-188362995 CCTGCTCTGGTGGAGGCGGCAGG - Intergenic
985416775 4:189742963-189742985 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
985788305 5:1911398-1911420 CCTTCTATGGATGGGGAGGCAGG - Intergenic
987405104 5:17517174-17517196 GCTACTATGGAGGATGAGGCAGG + Intergenic
988278467 5:29113860-29113882 CCTACTCTGGTGGAGGTGGCAGG + Intergenic
988875830 5:35444642-35444664 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
989499622 5:42150249-42150271 CCACATGTGGAGGAGGGGCCTGG + Intergenic
990243555 5:53839171-53839193 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
990456665 5:55995132-55995154 CCGCCTGTCGACGAGGGGGCGGG + Intergenic
990824244 5:59879339-59879361 CCGGCTGTGGAGGATGGGGCTGG - Intronic
991153298 5:63398231-63398253 CATTCTATGGAGGAGGAGACTGG - Intergenic
991214762 5:64149235-64149257 CCTTCTCTGGTGGAGGTGGCAGG + Intergenic
991720675 5:69492587-69492609 CTTCCTCTGGCGGAGGCGGCAGG + Exonic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
993771481 5:91933300-91933322 CCTCCTATGGTGGAAGGGCAAGG + Intergenic
994358039 5:98817023-98817045 CCTACTCTGGTGGAGGTGGCAGG - Intergenic
994500789 5:100574706-100574728 TCTACCAGGGAGGAGGGGGCGGG + Intronic
995388602 5:111615100-111615122 CCCCCTAGGGAGGAGGGGAAAGG - Intergenic
996141281 5:119912894-119912916 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
996631908 5:125643031-125643053 CCTGCTCTGGAGGAGGTGGCAGG - Intergenic
996978453 5:129461337-129461359 CCTCCGACGGCGGCGGGGGCCGG - Exonic
997586522 5:135046958-135046980 CCTCCCATGGAGGCTGGAGCTGG + Intronic
997618489 5:135269876-135269898 CCTCCTGAGGACGAGGGTGCCGG - Intronic
1000264553 5:159622003-159622025 CCTTCTCTGGTGGAGGTGGCCGG - Intergenic
1000978241 5:167788221-167788243 AATCCTATGAAGGAGGGGACTGG - Intronic
1001078419 5:168647642-168647664 GCACCTATTCAGGAGGGGGCAGG + Intergenic
1002106960 5:176884293-176884315 CCTCCTGGGGAGTAGGGAGCGGG - Intronic
1002107043 5:176884773-176884795 CGTCCTCTGAGGGAGGGGGCAGG + Intronic
1002128606 5:177065335-177065357 CCTCTGATGGAGGAGGGGAAAGG - Exonic
1005307853 6:24530914-24530936 CCACCCATGCAGGAGTGGGCAGG - Intronic
1006133692 6:31883310-31883332 GCTCCTCTGAAGGAGGGGCCGGG + Intronic
1006137782 6:31906419-31906441 CCTCCGAGGTAGGAGGGGGAGGG - Intronic
1006611877 6:35298910-35298932 TCTCCTTTGGAGGATGGGGCAGG - Intronic
1006682198 6:35805326-35805348 CCGCGGACGGAGGAGGGGGCGGG + Exonic
1007104871 6:39276787-39276809 CCTCCTCTCCAGGTGGGGGCAGG + Intergenic
1007259831 6:40555720-40555742 CCTGCCATGGGGGTGGGGGCAGG - Intronic
1007731724 6:43951527-43951549 CCTGCTCTGAAGGATGGGGCTGG + Intergenic
1008742185 6:54622978-54623000 CTTCCTCTGGAGTAGGGGGCAGG - Intergenic
1010474943 6:76275789-76275811 CTCCCTATGGAGGAGGGGAAAGG - Intergenic
1010862986 6:80937153-80937175 CCTCCTCTAGTGGAGGTGGCAGG + Intergenic
1012893276 6:104921014-104921036 GCTTCTATGCAGGATGGGGCTGG - Intergenic
1013221267 6:108080035-108080057 CCTGCTCTGGAGGAGGTGGCAGG + Intronic
1014420238 6:121235094-121235116 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1014591450 6:123276887-123276909 CCTCCTGTGGTGGAGAAGGCAGG + Intronic
1014878088 6:126685807-126685829 CCTACTCTGGTGGAGGTGGCAGG - Intergenic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1017681485 6:156868571-156868593 CCTCCTATGGTGGAAGGGGGTGG + Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018353479 6:162987742-162987764 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018471674 6:164102715-164102737 CCACCTGGGGAGGAGGGGGAGGG - Intergenic
1018632122 6:165830454-165830476 CCTCATATGGAGGCAGAGGCTGG - Intronic
1018700722 6:166423952-166423974 CCTCCCATGGAGGACTGCGCTGG + Intronic
1018781724 6:167073896-167073918 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1019289957 7:245521-245543 CCTCCAGTGGAGGCAGGGGCCGG + Intronic
1020115141 7:5471974-5471996 CCTCCTCGGGAGGCTGGGGCAGG + Intronic
1020332303 7:7032190-7032212 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1021391827 7:20102386-20102408 GCTACTATGGGGGTGGGGGCAGG + Intergenic
1022016115 7:26349944-26349966 GCCCTTATGGAGGAGGGAGCAGG - Intronic
1022089480 7:27098118-27098140 GCTCCTGTGGGAGAGGGGGCAGG + Intergenic
1023017795 7:35984040-35984062 CCTCCTTAGCAGGTGGGGGCAGG + Intergenic
1023319252 7:38975882-38975904 CTTCCTATGGGGCTGGGGGCTGG - Intergenic
1023821741 7:43984426-43984448 CCTCCTCAGGAGGAGGAGCCAGG + Intergenic
1024644431 7:51359313-51359335 ACTCCTATAGAGCATGGGGCTGG + Intergenic
1025087371 7:56034237-56034259 CCCCCGGAGGAGGAGGGGGCTGG - Intronic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1025852189 7:65252460-65252482 CCACCTAAGGAGGAGGGGAGGGG - Intergenic
1025899409 7:65731844-65731866 CCCCCGGAGGAGGAGGGGGCAGG - Intergenic
1026214590 7:68337162-68337184 GCTAATATGGAGGATGGGGCAGG + Intergenic
1026655588 7:72253850-72253872 GCTCCTCTGGAGGCGGAGGCAGG - Intronic
1028197193 7:87920714-87920736 CCTACTCTGGTGGAGGTGGCGGG - Intergenic
1028832878 7:95345447-95345469 CCTACTCTGGGGGTGGGGGCGGG + Intergenic
1029269855 7:99370723-99370745 CCTCCTCTGGAGGCTGAGGCAGG - Intronic
1029750004 7:102537845-102537867 CCTCCTCAGGAGGAGGAGCCAGG + Intergenic
1029767954 7:102636951-102636973 CCTCCTCAGGAGGAGGAGCCAGG + Intronic
1030019372 7:105257993-105258015 CCTACTCTGGAGGGGGAGGCAGG + Intronic
1030390398 7:108920731-108920753 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1031799337 7:126223146-126223168 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1032779009 7:135147342-135147364 CCTCCTTTGGAGGAAGGGCAAGG + Intronic
1033401189 7:141026798-141026820 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1033462702 7:141562047-141562069 CCTGCTGTGGTGGAGGTGGCAGG + Intronic
1033657320 7:143382387-143382409 CCTCCTCCGGAGGAGGCGGCGGG - Exonic
1033657327 7:143382394-143382416 CCTCCTCCGGAGGAGGAGGGAGG + Exonic
1033657599 7:143383500-143383522 GCTCCTCTGGAGGAGAGGCCTGG + Intronic
1034405707 7:150901252-150901274 CCTGCTCTGGAGCTGGGGGCAGG - Intergenic
1035001080 7:155612513-155612535 GCTCCTCTGGAGGCTGGGGCAGG + Intronic
1035242699 7:157542587-157542609 CATGCTATGGGGGAGGGGACGGG + Intronic
1035555223 8:562723-562745 CGTCCTCTGGAGGTCGGGGCAGG - Intergenic
1035591430 8:817849-817871 CCTGCTCCGGCGGAGGGGGCAGG + Intergenic
1036648397 8:10626090-10626112 GCCCCTGTGGAGGAAGGGGCAGG + Intronic
1038478028 8:27882468-27882490 CCTGCTAGGGAGGAGGGTGTAGG + Intronic
1039000944 8:32979616-32979638 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1040385137 8:46909886-46909908 CCTCCTCAAGAGGAGGGGACAGG + Intergenic
1042844804 8:73159086-73159108 CCCCACATGGAGGAGTGGGCTGG + Intergenic
1043986267 8:86696032-86696054 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1048296284 8:133216924-133216946 CCACCTTTAGAGGAGGGAGCAGG + Intronic
1048496773 8:134942166-134942188 CCTTCCATGGAGGTGAGGGCTGG + Intergenic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1049085454 8:140474889-140474911 CATAAGATGGAGGAGGGGGCTGG + Intergenic
1049493535 8:142917471-142917493 CATCCTTTGGAGGATGGGGAAGG - Intronic
1049558157 8:143293932-143293954 GCTCCTGTGGAGGTGGGGGTGGG - Intronic
1052894647 9:33735543-33735565 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1053503548 9:38621431-38621453 CCTCCGGTGGAGGAATGGGCGGG - Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054869695 9:70038015-70038037 CCTCCTCTGGAGGAGTGAGGAGG + Intergenic
1056026707 9:82505052-82505074 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1056718777 9:89055686-89055708 TCTCCCAAGCAGGAGGGGGCTGG + Intronic
1056939908 9:90946176-90946198 CTTCCTATTGAGAAGAGGGCAGG + Intergenic
1057684860 9:97222385-97222407 CCTCAGGTGGAGGAGTGGGCGGG - Intergenic
1058342956 9:103920720-103920742 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1060068336 9:120524787-120524809 TATCATATTGAGGAGGGGGCTGG + Intronic
1060494916 9:124111538-124111560 GCTCCCCTGGAGGAGGGGGATGG - Intergenic
1060979114 9:127782639-127782661 CCACTTTTGGAGGAGGAGGCAGG - Intergenic
1061095479 9:128454654-128454676 GCTACTAGGGAGGAGGAGGCAGG - Intergenic
1061749927 9:132770477-132770499 CACCCTGTGGAGGAGCGGGCTGG + Intronic
1061802655 9:133120833-133120855 CCACCTATGGAGGAGAGAGGAGG + Intronic
1062152708 9:135030164-135030186 CCACATCAGGAGGAGGGGGCAGG - Intergenic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062508245 9:136889393-136889415 CCTACTCTGGAGGATGAGGCAGG - Intronic
1203697147 Un_GL000214v1:109271-109293 CCTCAGGTGGAGGAGTGGGCGGG - Intergenic
1203636358 Un_KI270750v1:116683-116705 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1186748166 X:12592106-12592128 CTTCCTTTGGAGTATGGGGCAGG - Intronic
1186765586 X:12767638-12767660 CTTCATTTGGAGGCGGGGGCTGG - Intergenic
1189663327 X:43326843-43326865 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1189668380 X:43381435-43381457 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1191077234 X:56468406-56468428 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1191734018 X:64369607-64369629 CCTATCATGGAGGAGGGGGCAGG + Intronic
1191870754 X:65742944-65742966 CCTCCTACGGAGGCTGAGGCAGG - Intergenic
1191903521 X:66064082-66064104 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1192921571 X:75712841-75712863 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1193076638 X:77362666-77362688 CCTGCTCTGGTGGAGGGGGTAGG + Intergenic
1193203143 X:78715649-78715671 CCTCCTTTGGTGGAGGTAGCAGG - Intergenic
1193950757 X:87795383-87795405 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1194299033 X:92162719-92162741 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1194766532 X:97848773-97848795 CCAACTATGGAGGAGGGTGGTGG + Intergenic
1198043222 X:132874898-132874920 CCTCCTCTGGAAGGGGGGGGCGG + Intronic
1198057376 X:133008351-133008373 CCTTCTGTGGAGGCGGAGGCAGG - Intergenic
1198770266 X:140123404-140123426 CCTGCTATGGTGGAGGTGGCAGG + Intergenic
1199282882 X:146022569-146022591 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1200433721 Y:3121889-3121911 CCTCCTCTGGTAGAGGTGGCAGG - Intergenic
1200616636 Y:5387553-5387575 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1201153344 Y:11107328-11107350 CCTCAGGTGGAGGAGTGGGCGGG + Intergenic
1201900136 Y:19040679-19040701 CCTCCTCTAGAGGAAGGGGAAGG - Intergenic