ID: 1119478792

View in Genome Browser
Species Human (GRCh38)
Location 14:74947103-74947125
Sequence CTCCCTTGGGAGCCAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119478785_1119478792 -9 Left 1119478785 14:74947089-74947111 CCCTCAGCTGGTTCCTCCCTTGG 0: 1
1: 0
2: 0
3: 25
4: 351
Right 1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 397
1119478783_1119478792 4 Left 1119478783 14:74947076-74947098 CCAGGACATGCTACCCTCAGCTG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 397
1119478787_1119478792 -10 Left 1119478787 14:74947090-74947112 CCTCAGCTGGTTCCTCCCTTGGG 0: 1
1: 0
2: 2
3: 29
4: 309
Right 1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG 0: 1
1: 0
2: 2
3: 47
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119478792 Original CRISPR CTCCCTTGGGAGCCAGGGCA AGG Intronic
900112436 1:1014154-1014176 CCCCCTTGCCAGCCAGGGCCTGG + Exonic
900309716 1:2027855-2027877 CTGCCTGGGGAGCCGGGCCATGG + Intronic
900534564 1:3170560-3170582 CGCCCCTCGCAGCCAGGGCAGGG - Intronic
900634079 1:3653107-3653129 TTCCCTGAGGAGCCAGGGCCAGG + Intronic
900640392 1:3685583-3685605 CTCCCATGGGAGTCAGGGGTAGG - Intronic
900806867 1:4773287-4773309 CTCCCCTGGAACCCAGGGCAAGG + Intronic
901067123 1:6499461-6499483 CTCCCAGGGGAGCCAGGACCAGG - Intronic
901266464 1:7914279-7914301 CTCCGCTGGGAGGCAGGGGAGGG - Intergenic
901937432 1:12636470-12636492 TTCCCTTGGGAGGCAGGGTGGGG - Intergenic
902230079 1:15022209-15022231 ACCCGTTTGGAGCCAGGGCAGGG - Intronic
902689896 1:18104623-18104645 TTCCCTTGGGAGCCAGGTTGGGG + Intergenic
904083119 1:27884573-27884595 CTCCACTGGGAGCCAAGACACGG - Intronic
904959771 1:34323232-34323254 CCTCCTTGGGAGTCTGGGCATGG + Intergenic
905169034 1:36099016-36099038 CTGCCTGGGGCCCCAGGGCAGGG - Exonic
905633010 1:39529441-39529463 CTCACTACGGGGCCAGGGCAGGG - Intergenic
906239867 1:44236178-44236200 CACCCCTGGGTGCCAGGGCAGGG - Intronic
906318695 1:44803839-44803861 GTGCCCTGGGAGCCAGGGCAGGG + Intronic
912758717 1:112346919-112346941 TTCCCTGGTGAGCCAGGGAAAGG - Intergenic
913323339 1:117605958-117605980 CTCCCGGGGGAGCCAGGGGCGGG - Exonic
914804267 1:150981374-150981396 CTCCCTGGAGAGCCTGGGTAGGG - Intergenic
917976752 1:180244863-180244885 CTGCCCTGGGAGTCAGGTCAGGG - Intronic
918073338 1:181150108-181150130 CTCCCCAGGGAACCAGGGCAGGG - Intergenic
918214868 1:182384650-182384672 CTCCCTTGGGATCATAGGCACGG + Exonic
918412111 1:184270728-184270750 CTTCCCAGGGAGCGAGGGCATGG - Intergenic
919271928 1:195359754-195359776 CACCCTTGGAAGCCATGGCATGG + Intergenic
919810025 1:201403159-201403181 ATGCTTGGGGAGCCAGGGCATGG - Intergenic
920648084 1:207817939-207817961 GGGCCTTGGGAGCCAGAGCAGGG - Intergenic
920652600 1:207850164-207850186 GTCCCCTGGGAGCCAGAGCTAGG + Intergenic
921018285 1:211212500-211212522 CTACCAAGGTAGCCAGGGCAGGG + Intergenic
922168489 1:223135392-223135414 CTCCATTCTGAGTCAGGGCAGGG + Intronic
922517105 1:226215585-226215607 CTCCCTGTGGAGCCAGGGGCTGG - Intergenic
922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG + Intergenic
922790032 1:228306259-228306281 CTGCCTGTGGAGCCAGGCCAGGG + Intronic
922855136 1:228768746-228768768 CTCCCTCTGGATCCAGGCCACGG + Intergenic
923804722 1:237245306-237245328 CTCTCTTTGGAGCTTGGGCATGG + Intronic
923857952 1:237864877-237864899 CTCCTGTGGGAGGCAGGGGAGGG - Intergenic
1062860122 10:804415-804437 CTCCCTGAGGAGCCAGGGCCGGG - Intergenic
1062925988 10:1315629-1315651 CTCCCTGGGAGGCCAGGGTAGGG - Intronic
1063675942 10:8140840-8140862 CTCCCCTGGAAGCCAGGGATGGG + Intergenic
1066103598 10:32138387-32138409 CTCCCTAGGGAGTGAGGGCGAGG + Intergenic
1067162901 10:43842353-43842375 CTCCCTGGGGGGTCAGGGGATGG + Intergenic
1069723619 10:70564270-70564292 CTGCCCTGAGTGCCAGGGCAGGG - Intronic
1069862689 10:71481370-71481392 CACCCTTGGGAGTCAGGAAATGG + Intronic
1069901196 10:71707557-71707579 TTCCCCTGTGAGCCAGGACATGG - Intronic
1069993580 10:72329352-72329374 GTCCCTAGGGAGGGAGGGCAGGG - Intergenic
1070214638 10:74363959-74363981 CTCCCTTGGGATCTGTGGCATGG + Intronic
1072757616 10:98031009-98031031 GTCCCTCGGGAGGCAGCGCAGGG + Intergenic
1072805841 10:98423715-98423737 CCCCCTGGGTGGCCAGGGCAGGG - Intronic
1073062002 10:100738835-100738857 ATCCCTCAGGAGCCAGGACAGGG - Intronic
1073144402 10:101271094-101271116 CTGCCTTAGGAGTCAGGGCAAGG + Intergenic
1073473885 10:103740476-103740498 CTCCCATGAGAGCCAGGGCCTGG + Intronic
1074118337 10:110474602-110474624 CATCCCTGGAAGCCAGGGCAGGG + Intergenic
1074218181 10:111408749-111408771 CTCCCTTGGCACCCTAGGCAAGG + Intergenic
1074843533 10:117376678-117376700 GTACCTAAGGAGCCAGGGCAGGG + Intergenic
1076498299 10:130914001-130914023 CTCCCCAGGGAGCCTGGGCCTGG - Intergenic
1076673766 10:132137178-132137200 GCCCCTTGGGAGCCAGAGGACGG - Intronic
1076696538 10:132249896-132249918 CTCCTTTGGGAGCCAGGAATGGG - Intronic
1076884226 10:133254314-133254336 TCCCCTTGGGAGCCAGGCCCTGG + Intergenic
1076918628 10:133440010-133440032 CTCCTCTGTGAGCCAGGGAAAGG - Intergenic
1076922243 10:133460027-133460049 CACACTTCGGAGCCGGGGCAGGG + Intergenic
1077287570 11:1774448-1774470 CTCCCCAGTAAGCCAGGGCAGGG - Intergenic
1077504704 11:2924600-2924622 CTCCCTTGGCAGGCCTGGCAGGG + Intronic
1077530265 11:3091695-3091717 GTCCCTTGGCAGGCAGAGCATGG + Intronic
1078902930 11:15658362-15658384 CTCCCTTGGGGTGTAGGGCAAGG - Intergenic
1079388104 11:19998531-19998553 CCCCCTTGGAGGCCACGGCAAGG - Intronic
1081537498 11:44006163-44006185 CTCCTCTGGCAGCCAGGGCCTGG + Intergenic
1081990322 11:47333887-47333909 CTCCCCTGGGGGACAGGGAAGGG + Intronic
1083628954 11:64086044-64086066 CTCCATAGGGAGGGAGGGCAGGG - Intronic
1083636493 11:64123572-64123594 CTCCCCAGGGAGCCAAGCCAGGG - Intronic
1084743873 11:71155463-71155485 CTCCTCTGGGAGCGTGGGCAGGG - Intronic
1085053318 11:73390746-73390768 CTCCCACAGGACCCAGGGCAGGG + Exonic
1085244527 11:75089252-75089274 CTACCTTGGCAGCCAGTGCCTGG - Exonic
1085511885 11:77092516-77092538 CTCTCTTGGCAGGCAGAGCAAGG + Intronic
1089344803 11:117784362-117784384 CTCCCTTGGCAGGCAGGGCGAGG - Intronic
1089960516 11:122613689-122613711 CTCCCTTGGGATCATGGGCGTGG + Intergenic
1090210297 11:124916349-124916371 GTCACCTGGGAGCCAGGGCCTGG + Intergenic
1091191157 11:133696330-133696352 CTACCATGGGAGCAAAGGCAGGG + Intergenic
1091831697 12:3554723-3554745 CTCCTGAGGGAGCCTGGGCAGGG + Intronic
1092108843 12:5945073-5945095 CCCCCAAGGGAGCCTGGGCAGGG - Intronic
1095723313 12:45424747-45424769 CTCCCTTCTGACCCAAGGCATGG - Intronic
1096696620 12:53353215-53353237 CTCCCTTGGAAGTCAGAGTAGGG + Intergenic
1096871654 12:54596266-54596288 CTTCCTTGGGAGGGAGGGGATGG + Intergenic
1097020293 12:56016008-56016030 TTCCCTAGGAAGCCAGGGCATGG - Intronic
1098792634 12:74844685-74844707 CTCTCATGTGAGCCAGGGCAGGG - Intergenic
1100479265 12:94962212-94962234 CTTCCTAGGGAGGCTGGGCATGG + Intronic
1101329487 12:103745994-103746016 CTCCCTGGGGTCACAGGGCATGG + Intronic
1102222432 12:111203668-111203690 CTCACATGGGAGCCATGGAAGGG + Intronic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1102932954 12:116876541-116876563 CTGCCTTGGGAGCAGGGGAAGGG - Intronic
1102957156 12:117066151-117066173 CTCCCTAGGGTTCCAGGGGATGG + Intronic
1103703890 12:122861262-122861284 CTCCCTGGGGAGGCTGGGCTGGG + Intronic
1103774151 12:123353086-123353108 CTCCTTTGGGAGGCTGGGCGCGG - Intronic
1104593653 12:130104635-130104657 CCCCTTTGAGATCCAGGGCAGGG + Intergenic
1104804111 12:131574117-131574139 CTTCCTTGGGATCCTGGGGAGGG - Intergenic
1104860096 12:131919111-131919133 CGCCTTGGGGAGGCAGGGCAGGG - Intronic
1104898415 12:132175414-132175436 CTCCCTGGGGCTCCAGGGCAGGG + Intergenic
1106465865 13:30014088-30014110 CACCCCTGGGATCCAGGGTATGG - Intergenic
1107807375 13:44166264-44166286 CTGTCTAGGGAGGCAGGGCAGGG + Intergenic
1110589444 13:77238300-77238322 CTCCCATGTAAGCCAGGACATGG + Intronic
1112001174 13:95211326-95211348 CTGCCTTGGGAGACAGGGCTAGG + Intronic
1112006134 13:95255329-95255351 CTCCCCTTGGAGCCAGGCCATGG - Intronic
1112303050 13:98247611-98247633 CTCTGCTGGGATCCAGGGCAGGG + Intronic
1118059071 14:62116057-62116079 CTGTCTTTGGAGCCAGGGCAGGG - Intergenic
1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG + Intronic
1119766196 14:77189711-77189733 CTCCCTGGGGAGTCAGGAAAGGG + Intronic
1121508160 14:94492177-94492199 CACCCTTGGGACCCTGGGAAGGG + Intronic
1121531296 14:94656080-94656102 AACCTTTAGGAGCCAGGGCATGG + Intergenic
1121622669 14:95361149-95361171 GTCCCCTGGGATCCAGGGCTGGG - Intergenic
1121774917 14:96584249-96584271 CTCCCTGGGGACCCCTGGCAAGG + Intergenic
1122527158 14:102395267-102395289 CTCACTTGGTACCCAGAGCAAGG + Intronic
1122652406 14:103232739-103232761 CTCCCATAGGTGCCAGGGCTTGG + Intergenic
1122814881 14:104307456-104307478 CACCCTGGGGAGCCTGGTCACGG - Intergenic
1124374553 15:29121988-29122010 CACTCCTGGGTGCCAGGGCAGGG - Exonic
1124622244 15:31280320-31280342 CTCCCCGGGGAGCCATGGGAGGG - Intergenic
1125268816 15:37915522-37915544 CTCCCATGGGAGGGAGGGGAAGG + Intergenic
1125717162 15:41825920-41825942 CTCCCGTGGCTGCCAGAGCAGGG + Exonic
1126039659 15:44577921-44577943 CTTGCTTGGGAGCCAGGACAAGG - Intronic
1126735258 15:51726442-51726464 CTCACTCTGGAGCCAGGGGAGGG - Intronic
1127859683 15:62982980-62983002 CTCCCCTGCCAGCCAGGGAAAGG - Intergenic
1129035997 15:72648651-72648673 CTCACTAGAGAGCCAGGGCAGGG - Intergenic
1129213888 15:74088565-74088587 CTCACTAGAGAGCCAGGGCAGGG + Intergenic
1129391534 15:75223362-75223384 CTCACTAGAGAGCCAGGGCAGGG - Intergenic
1129400124 15:75276798-75276820 CTCACTAGAGAGCCAGGGCAGGG - Intronic
1129472769 15:75764492-75764514 CTGACTAGAGAGCCAGGGCAGGG + Intergenic
1129695987 15:77741002-77741024 CTCTTTTGGGGGCGAGGGCAGGG - Intronic
1129731025 15:77932910-77932932 CTCACTAGAGAGCCAGGGCAGGG + Intergenic
1129906770 15:79193297-79193319 CTTCCTTGGTTGCCATGGCAGGG + Intergenic
1129970622 15:79774916-79774938 CTCCCTTGGAGGCAGGGGCAGGG - Intergenic
1131079591 15:89523446-89523468 CTGGCTTGGTAGCCAGGTCACGG + Intergenic
1131381185 15:91965267-91965289 ATCCCTGAGGAGCCAGGGCTTGG - Intronic
1131990518 15:98088693-98088715 CTCTCTGGGGAGCCAGGGGTTGG - Intergenic
1132099626 15:99014602-99014624 CTCTCTGGGGAGCCAGGGGTTGG + Intergenic
1132849807 16:2019900-2019922 CTCCCCTGGGCGCCACGCCAGGG - Exonic
1133206503 16:4237346-4237368 CCAGCTTGGGAGCCAGGCCAGGG - Intronic
1134309507 16:13062893-13062915 CTCCCTCGGGAGCCAGGATCAGG - Intronic
1134467454 16:14492059-14492081 CACCCTTGGGAGCCAGAGCTTGG + Intronic
1135303400 16:21349732-21349754 CTCCCCTGGCAGGAAGGGCAGGG - Intergenic
1135588780 16:23690835-23690857 CTCCCTGTGGCCCCAGGGCATGG + Exonic
1136240789 16:28942556-28942578 CTACATTGTGAGCCAGGGCCTGG + Intergenic
1136247950 16:28985909-28985931 CTACCTTGGGTGCCAGGGAGAGG + Intronic
1136300148 16:29328926-29328948 CTCCCCTGGCAGGAAGGGCAGGG - Intergenic
1136366245 16:29810543-29810565 GTCCCTGGGAAGACAGGGCATGG - Exonic
1136417527 16:30112985-30113007 CTCACATGGCAGCCTGGGCAGGG + Intronic
1136688238 16:32008726-32008748 CTGCCTTGGGCACCAGGGCCTGG + Intergenic
1136788840 16:32952281-32952303 CTGCCTTGGGCACCAGGGCCTGG + Intergenic
1136880972 16:33901653-33901675 CTGCCTTGGGCACCAGGGCCTGG - Intergenic
1136991316 16:35152896-35152918 CCCACTTGGGACACAGGGCAGGG - Intergenic
1137675964 16:50304038-50304060 CTCCCTGGGGAGGCAGAGCAGGG + Intronic
1137794449 16:51203509-51203531 CTTTCTTGGGAGGAAGGGCAAGG + Intergenic
1139510277 16:67424164-67424186 CTCCCCAGGGAGCCTGTGCAGGG - Intergenic
1139531743 16:67545876-67545898 CTCCCTTGAGGGCGAGGGCTGGG + Intronic
1139550165 16:67668426-67668448 CTCCGAGGGGAGCCAGGGCATGG - Exonic
1141161113 16:81629743-81629765 CTCCCTTGGGCGCTGTGGCACGG - Intronic
1141879491 16:86848325-86848347 CTCCCCGAGGAGCCAGGGCCTGG + Intergenic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1142061880 16:88035696-88035718 CTCCCCTGGCAGGAAGGGCAGGG - Intronic
1142106070 16:88303488-88303510 GTTCCATGGGAGCCAGGGCCAGG - Intergenic
1142201383 16:88762601-88762623 CACCCGTGGCAGCCAAGGCAAGG + Intronic
1203091037 16_KI270728v1_random:1213770-1213792 CTGCCTTGGGCACCAGGGCCTGG + Intergenic
1144950030 17:18989065-18989087 GTCCCTTGGCAGCAAGGGGAGGG + Intronic
1146591263 17:34129896-34129918 CCCCCTTGAGAGGCAGGACATGG - Intronic
1146594557 17:34157359-34157381 CTGCCTTGGGGGGAAGGGCAGGG + Intronic
1146658877 17:34651542-34651564 CTCCCCTGGGCCCCAGCGCAGGG + Intergenic
1146842602 17:36166262-36166284 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1146854914 17:36254221-36254243 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1146865706 17:36334155-36334177 GTCCGTTGGGAGGCGGGGCATGG - Exonic
1146870814 17:36378113-36378135 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1146884474 17:36461975-36461997 CTGGCTTGGCAGCCATGGCAAGG - Intergenic
1147068575 17:37934767-37934789 GTCCGTTGGGAGGCGGGGCATGG - Exonic
1147073698 17:37978737-37978759 GTCCGTTGGGAGGCGGGGCATGG + Intronic
1147080098 17:38014304-38014326 GTCCGTTGGGAGGCGGGGCATGG - Intronic
1147085219 17:38058275-38058297 GTCCGTTGGGAGGCGGGGCATGG + Exonic
1147096047 17:38138264-38138286 GTCCGTTGGGAGGCGGGGCATGG - Intergenic
1147101166 17:38182241-38182263 GTCCGTTGGGAGGCGGGGCATGG + Intergenic
1147165758 17:38592357-38592379 CACCTTGGGGAGGCAGGGCAGGG - Intronic
1147384699 17:40074311-40074333 CCCCCTTGGGGCGCAGGGCATGG + Exonic
1147448378 17:40488781-40488803 CTTCTCTGGGAACCAGGGCAGGG - Exonic
1147466468 17:40614912-40614934 TTCCCGGGGGAGCCAGGCCAAGG - Intergenic
1148020219 17:44548364-44548386 CTCCCTTGGGAGGGAGGAAAAGG - Intergenic
1148124863 17:45231361-45231383 CTCCCCTGGGAGCCAAGGCTGGG + Intronic
1148291858 17:46458829-46458851 TTCCCATGGGAGGCCGGGCACGG - Intergenic
1148314048 17:46676520-46676542 TTCCCATGGGAGGCCGGGCATGG - Intronic
1149604402 17:57914659-57914681 CTCCCCTGGGAGTCTGGACATGG - Intronic
1149845764 17:60008747-60008769 GTCCGTTGGGAGGCGGGGCATGG + Intergenic
1150084112 17:62265327-62265349 GTCCGTTGGGAGGCGGGGCATGG + Intergenic
1151460084 17:74249233-74249255 CTCCCTTGGGAGCTCAGGGACGG + Intronic
1151463297 17:74268581-74268603 CTCCCTTGAGAGCCAGGTAAAGG - Intergenic
1151663404 17:75531698-75531720 ATTCCTAGGGAGCCAGGGCTGGG - Intronic
1151713886 17:75821749-75821771 CTGCCCTGGGGGCCAGAGCAGGG + Intronic
1152537410 17:80958926-80958948 CTCCCTGGGGACCCAGAGGAAGG - Intronic
1153762403 18:8344694-8344716 CACCCTTAGGAGGCTGGGCAGGG + Intronic
1154398761 18:14014713-14014735 CTTCCTGGGGAACCACGGCAAGG - Intergenic
1156900909 18:42299393-42299415 CTGGGTCGGGAGCCAGGGCAGGG + Intergenic
1157283383 18:46360653-46360675 CTTCCCTGGGGGCCAGGGGATGG + Intronic
1157580643 18:48771995-48772017 CTCCCTGGGGAGCCAGGGACAGG - Intronic
1158546039 18:58397973-58397995 CTCACATGCCAGCCAGGGCAGGG - Intronic
1158731152 18:60023816-60023838 CTGCCTGAGGAACCAGGGCAGGG + Intergenic
1160120463 18:76126238-76126260 CTCCCCTAGGACCCAGGACATGG - Intergenic
1160269327 18:77370034-77370056 TGCCCTTGGGAGAAAGGGCAGGG + Intergenic
1160529129 18:79553347-79553369 CTCCCTGGGGAGCCTGGGTTAGG - Intergenic
1161231438 19:3176895-3176917 CTCCCTTGGACCCCAGGACAGGG + Intronic
1161354227 19:3810245-3810267 CTCCGTGGGGAGCGTGGGCATGG + Intronic
1161420990 19:4175804-4175826 CTCCCCTGGAGCCCAGGGCATGG + Intronic
1161425857 19:4202744-4202766 GTCCCTTGGGGGCCACGGAAGGG + Intronic
1161439843 19:4284719-4284741 CTACCTTGGGGGGCGGGGCAGGG - Intronic
1161594156 19:5142651-5142673 CTCCCTGGGGAGCCTGGGGGTGG - Intronic
1161667599 19:5586549-5586571 CACACTTGGCAGCCAGGGGAGGG + Intergenic
1161999416 19:7733743-7733765 CACCTTGGGGAGCCAAGGCAGGG + Intronic
1163421778 19:17217554-17217576 CTCCTGTTGGAGTCAGGGCATGG - Intronic
1163554808 19:17985788-17985810 CAGCCTTTGGATCCAGGGCAAGG + Intronic
1163786887 19:19279403-19279425 CTCGCCAGTGAGCCAGGGCACGG + Intronic
1165068219 19:33241122-33241144 CTCCCTTCCGGGCCAGGGCCAGG - Intergenic
1165310657 19:35027716-35027738 CTCCCTCTGGAACCAGGACAAGG - Intergenic
1165648917 19:37469014-37469036 CTCCCTTAGCAACCAGGGCGGGG - Intronic
1165920784 19:39296786-39296808 CTTCCTAGAGAGCAAGGGCAGGG - Exonic
1166269331 19:41704309-41704331 CTTCCTTGAGGGCCAGGGCAGGG + Intronic
1167643763 19:50695210-50695232 CTCCCGCGGGAGGGAGGGCAGGG + Intronic
1168132335 19:54329597-54329619 CTCCCATGGGAGCCACTCCAAGG + Intergenic
925810487 2:7695283-7695305 CTCACCTGGGAGCCTGGGAAAGG + Intergenic
927080603 2:19626100-19626122 CTCCCTGGGGTGCATGGGCATGG + Intergenic
927215643 2:20666778-20666800 CGGCATTGGGAACCAGGGCAGGG + Exonic
927558084 2:24049895-24049917 CTCCCTCCGGAGCCAGGGGAGGG + Intronic
929874350 2:45784213-45784235 CTTCCTTGGGATCCTGGCCAAGG - Intronic
931620358 2:64204147-64204169 CTGGGTTGGGAGCCTGGGCAGGG + Intergenic
932015706 2:68024240-68024262 CTGCCTGAGGAGCCAGGCCATGG + Intergenic
932446749 2:71786318-71786340 CTCCCTGGAAGGCCAGGGCAAGG + Intergenic
932699570 2:73984192-73984214 CTCCTCTGGGAGGCAGGGCGGGG + Intergenic
933713717 2:85345335-85345357 CTCCCTGAGGAGCCGGGGAAGGG - Intronic
933885841 2:86719346-86719368 CTTCCTAGGGAGCAAGGGCCAGG + Intronic
933924339 2:87077359-87077381 CTTCCTAGGGAGCAAGGGCCAGG - Intergenic
934502830 2:94872960-94872982 CTTCCTTGTGTGCCAGGGCCCGG - Intronic
934870401 2:97860055-97860077 CTCCCTTGGCATCCATGCCATGG + Intronic
934924202 2:98370499-98370521 TTCCCCTGGAAGCGAGGGCAGGG - Intronic
935639018 2:105273076-105273098 CTCCCCTGTCAGCCAGGGCTTGG + Intronic
936086696 2:109474202-109474224 CTCCCTAGAGAGCCACTGCATGG - Intronic
936612129 2:114011627-114011649 CTACCTGGGGACCCAGAGCAGGG - Intergenic
936620714 2:114094249-114094271 CTTCCTTGGGAACCAGTGCTGGG - Intergenic
940852654 2:158703036-158703058 CTCCCTGGAGGGCTAGGGCAGGG + Intergenic
941085780 2:161115878-161115900 CTCCCTTTGGTGCAAAGGCAGGG - Intergenic
942292376 2:174486203-174486225 CTCCCTAGAGACCCAGGGTAGGG + Intronic
943309596 2:186309880-186309902 CAGCCTTGGCAGCAAGGGCATGG + Intergenic
944118955 2:196219892-196219914 CTCCCTTGAGACCTTGGGCAAGG - Intronic
944635881 2:201675710-201675732 CACCCCTGGGCTCCAGGGCAAGG + Intronic
945665347 2:212734676-212734698 CAGCCTTGGGAGCCTGGGAACGG - Intergenic
947196731 2:227575101-227575123 CTCACTTGGGAGCCAGGACCTGG + Intergenic
947874779 2:233460919-233460941 TGCCCTCGGGAGCCAGGGCAGGG - Intronic
948273116 2:236688863-236688885 CTCCCATGGGAGGGAGGGCAGGG - Intergenic
948993340 2:241565366-241565388 CTGACTAGGGAGCTAGGGCAGGG + Intronic
1168806822 20:676501-676523 CTCCAGTGGGAGCCCGAGCAGGG - Intergenic
1169933367 20:10857609-10857631 CTGCCCTGGGACCCTGGGCAGGG + Intergenic
1170603555 20:17859666-17859688 CTCCCTCAGGAGCCTGGGCGCGG - Intergenic
1170967425 20:21087313-21087335 CTGCCTAGAGAGCCATGGCATGG + Intergenic
1171322860 20:24261756-24261778 CTCCCATCTGAGCCAGGGCCTGG + Intergenic
1171780214 20:29410857-29410879 CTTCCGGAGGAGCCAGGGCAGGG + Intergenic
1171942990 20:31349102-31349124 GCCACTTGGGAACCAGGGCATGG - Intergenic
1171960312 20:31488706-31488728 TTCCCTTCGTGGCCAGGGCAGGG - Intergenic
1172898928 20:38320140-38320162 CTGCCGTGGGAGCCAGCTCATGG + Intronic
1173170414 20:40718881-40718903 CTCTCCTGGGTGCCAGGTCAAGG + Intergenic
1175213315 20:57375416-57375438 CCCCATCGGAAGCCAGGGCAGGG - Intronic
1175400461 20:58697251-58697273 CTCCTGTGGGAGGGAGGGCAGGG - Intronic
1175764579 20:61583471-61583493 CTTCCATGGGACCCAGGGAATGG - Intronic
1175783470 20:61697930-61697952 CTCCCTGCAGAGCCAGGGCTGGG + Intronic
1175826440 20:61938884-61938906 CTCCCTGGGCAGCCATGGGAGGG - Exonic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1175991753 20:62793370-62793392 CTCCAGTGGGAACCTGGGCAGGG - Intergenic
1176022129 20:62967259-62967281 CTACCTTGGGAACCAGGGTGGGG + Intronic
1176258449 20:64166231-64166253 CTACCGAGGGAGACAGGGCAGGG - Intronic
1178887142 21:36493319-36493341 CTTCCCTGGGAGGCAGGGCACGG + Intronic
1178892842 21:36534394-36534416 CCCCCGTGGGAACCAGAGCAAGG + Intronic
1179900440 21:44390623-44390645 GTCGCTTAGGGGCCAGGGCATGG + Intronic
1180048125 21:45319001-45319023 CTCACTTCAGAGCCAGGCCAAGG + Intergenic
1180224892 21:46386470-46386492 CTCCATTGGGAGCCTGTGCCTGG + Intronic
1181055459 22:20258671-20258693 CTCCCCTGGCTCCCAGGGCAGGG + Intronic
1181101780 22:20545657-20545679 TTCCCTTGGTGGCCAGGTCAGGG + Intronic
1181621896 22:24096801-24096823 CCCACATGGGAGCCAGGGGAGGG + Intronic
1181622141 22:24098404-24098426 CCCACCTGGGAGCCAGGGGAGGG + Intronic
1181683759 22:24514572-24514594 CTCCTAAGGGTGCCAGGGCAGGG - Intronic
1182149965 22:28020987-28021009 CTGCCTTGGAAGCCAGGTGAGGG - Intronic
1183193349 22:36336025-36336047 TTCCCTTGGGAACCAGGGATCGG + Intronic
1183206958 22:36426319-36426341 CTCCAGGGGGAGACAGGGCAGGG - Intergenic
1183312017 22:37115285-37115307 CTCCTCTGGGCTCCAGGGCAGGG + Intergenic
1183705119 22:39471170-39471192 TGACCTTGGAAGCCAGGGCAGGG + Intronic
1184461532 22:44640548-44640570 CTCCCGTGGGAGCCAGGGCCAGG + Intergenic
1184643601 22:45884755-45884777 CCCTCGTGGGAACCAGGGCAAGG + Intergenic
1184644864 22:45890165-45890187 CTCCCCTGGGAACCAGCGCCAGG + Intergenic
1185066686 22:48635766-48635788 GTCCCTGAGGAGCCAGTGCAGGG + Intronic
1185079946 22:48704071-48704093 CTACCTTGGGCGCCATGGTACGG + Intronic
1185223903 22:49642445-49642467 CTCCCAGGGAAGCCAGGGCTGGG + Intronic
950032096 3:9860079-9860101 CTGCCTTGGGTGCCAAGGCTGGG + Intergenic
950424795 3:12919346-12919368 CTCCCTTGGGAGGCAGGAAGGGG - Intronic
950651858 3:14412209-14412231 CTCCTTTCAGAGCCAGGGCTAGG - Intronic
950673352 3:14540138-14540160 CTCCCTGGAGACCCAGGGCTTGG - Intronic
950740572 3:15047982-15048004 GGCCCTTGAGAGCCAGGGCCTGG + Exonic
950787686 3:15449814-15449836 CAGCCTTGGGACCCAGGACAGGG + Intronic
952416159 3:33093067-33093089 CTCTCTTGGCAGCCAGGGGCTGG + Exonic
952811826 3:37411177-37411199 GTCGCCTGGGAGCCAGGGCCTGG + Exonic
952869547 3:37886221-37886243 CACCCTTGAGGGCCAGGGAAGGG - Intronic
953593206 3:44280841-44280863 TTCCATTGGGCCCCAGGGCAGGG + Intronic
953912923 3:46901879-46901901 ACCCCTGAGGAGCCAGGGCATGG - Intronic
954129369 3:48552292-48552314 TGCCCTTGGGACTCAGGGCATGG + Intronic
955327608 3:58021250-58021272 GTCCCCTGGGAGGCAGGGCCTGG - Intronic
955530247 3:59865523-59865545 CTCCCCTTGGAGCCAGGGCCTGG + Intronic
955856601 3:63279029-63279051 CCCCCTTGGGAGATAGGGGAGGG + Intronic
955920300 3:63947961-63947983 GGACCTTGGGAGCCAGGGTAAGG + Intronic
956782678 3:72616722-72616744 CTCCTTTGGGAGGCAGTGCGGGG + Intergenic
957810384 3:85214572-85214594 GCCACTTGGGAGCCAGGGCCTGG + Intronic
958905097 3:99933325-99933347 TTCCCTAGGTAGCCAGGGAAAGG + Intronic
959020476 3:101182878-101182900 CTCCCCAGGAAGCCAAGGCAGGG + Intergenic
960372870 3:116862578-116862600 TTCCATTGGCAGCCAGGGGAAGG - Intronic
961158311 3:124700045-124700067 CTGCCTGGGGGGCCAGGGCTGGG - Intronic
961467501 3:127090563-127090585 CTCCCTGGGGGCCCAGTGCAGGG - Intergenic
961784847 3:129341516-129341538 CTGCCTTGGGTGCCAAGGCTGGG + Intergenic
967918768 3:194599002-194599024 CAGCCTTGGCAGCCAGGCCAGGG + Intronic
967975345 3:195031285-195031307 GTCCCTCGGCAGCCAGGGCAGGG + Intergenic
968316517 3:197730250-197730272 CTCCCTTAGGATCCAGGGTTGGG + Intronic
968473321 4:791722-791744 CTACCCTCGGGGCCAGGGCACGG + Intronic
968633924 4:1667982-1668004 CTCCCTTGGGAGGCGCGGCTAGG + Intronic
968782828 4:2596215-2596237 TGCCCTTGGGAGCCATGGAAAGG - Intronic
969531620 4:7733846-7733868 CCCCAGTGGGAGCCAGGTCAAGG + Intronic
970050862 4:11913412-11913434 CTTCCTTGGGAGCCACGTTATGG + Intergenic
970499875 4:16666259-16666281 CTCCCGTGTGAGCCAGAGAAAGG - Intronic
970804321 4:20012814-20012836 CTGACTTGAAAGCCAGGGCAGGG + Intergenic
973348511 4:49082757-49082779 GTCACTTGGGAGCTAGGGCTTGG - Intergenic
975503867 4:75117092-75117114 CTCATTTGGGAGCTAGGGCCTGG - Intergenic
975579209 4:75891793-75891815 CTCCCTTGGGCAGCAGGGCTCGG - Intronic
976108465 4:81644580-81644602 TTGCCTTTGAAGCCAGGGCATGG + Intronic
977450618 4:97191851-97191873 TTGCCTTTGGTGCCAGGGCATGG - Intronic
982781232 4:159493186-159493208 CACCCCTGGAAGGCAGGGCATGG + Intergenic
985134337 4:186770222-186770244 GTCCCTAGGGATCCAGGGGATGG - Intergenic
985832182 5:2242021-2242043 GTCCCCGGGGAGCCAGGGCAGGG - Intergenic
985965513 5:3336428-3336450 TTCCCTAGGGAGCCCGGGGAGGG + Intergenic
986778605 5:11043971-11043993 CTCACTAGGGAGCCCAGGCAGGG + Intronic
987379697 5:17273789-17273811 CTCCCTTGGGGTCCAGGGCAAGG + Intronic
993389222 5:87297895-87297917 CTTCCTTGGGAACCAGTGCCAGG - Intronic
993842922 5:92902234-92902256 ATACCTTGGGGGCCAGGGTAAGG + Intergenic
994845775 5:104986911-104986933 CTCCCCTTTGGGCCAGGGCAGGG + Intergenic
996094473 5:119383698-119383720 GTCTCTTGGAAGCAAGGGCAAGG + Intronic
996550217 5:124722651-124722673 CTCCCTTTTGAGAAAGGGCAGGG + Intronic
996930192 5:128877006-128877028 CTACATTAGGAGCCAGGACAGGG - Intronic
997582612 5:135027263-135027285 CTCTCCTCGGAGCCAGGGCCAGG - Intergenic
998490321 5:142540831-142540853 CTCACTTGGGAGCGGGGGCTGGG + Intergenic
999254767 5:150204168-150204190 CTCCCTTGGGAGATAGGGCCGGG - Intronic
1000807111 5:165809594-165809616 CTACCTTGTAAGCAAGGGCATGG + Intergenic
1001095445 5:168772319-168772341 CTCCCTTCGGAGACAGACCATGG - Intronic
1002158645 5:177302305-177302327 CTGCCTTGGCTGCCAGGGCAAGG - Intronic
1002176664 5:177404681-177404703 CTCCCTGGGCAGCCAAGGCTGGG + Intronic
1002316674 5:178348489-178348511 CTCCCTTGGCAGTCAGGGTTGGG + Intronic
1002536319 5:179878198-179878220 CTTCCTTGGGACACAAGGCAGGG + Intronic
1002613765 5:180437618-180437640 GGCCCCTGGGAGCCAGGTCAAGG - Intergenic
1002721185 5:181262080-181262102 CTCCCTGGGGAGGGAGGGCTGGG + Intergenic
1003174528 6:3745157-3745179 CTCCCTCTTTAGCCAGGGCAGGG + Intronic
1004206060 6:13592589-13592611 CTCCCTGAGGCTCCAGGGCAGGG - Intronic
1005811553 6:29519806-29519828 CTCCTTCGGGATGCAGGGCAAGG + Intergenic
1006488870 6:34368448-34368470 ATCCCCTGGGCTCCAGGGCATGG + Intronic
1006637250 6:35469325-35469347 GGCCCTTGGGACCCAGGGCTAGG + Intronic
1006800505 6:36756720-36756742 CTCCTTTGGGACCCAGCCCAAGG + Intronic
1007229930 6:40341097-40341119 TTCCCTTGCCAGCCAGGGAATGG + Intergenic
1007250563 6:40492238-40492260 CACCCTTGGGACTCAGGGGAGGG - Intronic
1011650330 6:89500227-89500249 CTCTCCTGGGAGGCAGGGCTGGG - Intronic
1014840734 6:126217873-126217895 GCCACTTGGGAGCCAGGGCCTGG + Intergenic
1015194665 6:130511910-130511932 TTCCCTTGGTATCCAGGACAGGG + Intergenic
1017687072 6:156924165-156924187 CCCCCTTGTCAGCCAGGGGATGG + Intronic
1018957290 6:168418764-168418786 GGCCCTGGGGAGCCTGGGCAGGG - Intergenic
1018982785 6:168613382-168613404 CCCCTTGGGGAGCCTGGGCATGG + Intronic
1019335466 7:480623-480645 AGCCCCTGGGAGCCAAGGCAGGG + Intergenic
1019506177 7:1392682-1392704 GCCCCCTGGGAGCCAGGGCCTGG + Intergenic
1019794014 7:3036462-3036484 CTCCCTTAGGGGACAGGGGAGGG + Intronic
1020006549 7:4786440-4786462 CATCCCTGGGTGCCAGGGCAGGG + Intronic
1020679618 7:11220607-11220629 CTCACTTGGCAGAAAGGGCAAGG + Intergenic
1020917424 7:14213524-14213546 CTCCCTCTGGAGCAAGGGGAAGG + Intronic
1021574372 7:22094082-22094104 CGGCATTGGGGGCCAGGGCATGG - Intergenic
1022106050 7:27199013-27199035 CACCCCTGGGAGCCCGAGCATGG - Intronic
1022233940 7:28443349-28443371 CTCCCTTGGGAGCAAAGGTCAGG - Intronic
1022555605 7:31292294-31292316 CTCACTAGGGAGCCAGGTTAAGG + Intergenic
1023245318 7:38197253-38197275 CTAGCTTGGGAGACAGAGCAAGG - Intronic
1023967948 7:44972956-44972978 GCCCCTTGGGACACAGGGCAGGG - Intronic
1027145032 7:75688382-75688404 CTCCCCTGGGAGCCCGGACCCGG - Intronic
1027229007 7:76261451-76261473 CTCCCGTGGGGCCCAGGGCCAGG + Intronic
1028415057 7:90570820-90570842 CTCCCTTGGGAACCAGCAGAGGG - Intronic
1029438020 7:100573446-100573468 CACCCTTGGGCTCCAGGGGAGGG - Exonic
1029667850 7:102007448-102007470 CGCCCCTGGGTGCCAGGGCCTGG + Intronic
1029712728 7:102308460-102308482 ACCCCTGGGGTGCCAGGGCATGG + Intronic
1031919034 7:127588288-127588310 CTCCCCTAGGAGCCAGAGCCGGG + Intronic
1032018024 7:128392187-128392209 CTTCCTGGGGAGGCAGGGCCTGG + Intergenic
1033867827 7:145713886-145713908 TTCATTTGGGAGCTAGGGCATGG + Intergenic
1034630400 7:152526087-152526109 CTCCCCTGGCAGCCAGGGGAGGG - Intergenic
1034745842 7:153523508-153523530 GTCCATCGGGAGCCTGGGCATGG + Intergenic
1034975767 7:155448636-155448658 CTGCGGTGGGAGCCAGGGCGCGG + Intergenic
1035327854 7:158076390-158076412 CTCCCTGGGGAGCTGGTGCATGG + Intronic
1035451349 7:158979159-158979181 TTCCCTTGGGTTTCAGGGCAGGG - Intergenic
1035600210 8:892875-892897 ATCCCTAGCCAGCCAGGGCATGG + Intergenic
1036286461 8:7447821-7447843 ATCCCTGGGGAGCCAGTCCATGG + Intronic
1036335015 8:7863707-7863729 ATCCCTGGGGAGCCAGTCCACGG - Exonic
1036496191 8:9271962-9271984 CCTCCCTGGGAGCCAGGGTAAGG + Intergenic
1036774009 8:11597659-11597681 AGGCCTTGGGATCCAGGGCAGGG - Intergenic
1037319072 8:17627078-17627100 CTCCCCTGGGAGCCCCAGCACGG - Intronic
1037758584 8:21727309-21727331 CTCCCATGGGAGCCAGGGACAGG + Intronic
1037823402 8:22146760-22146782 CTCCCGTGGGCGGCAGGGCAGGG + Intergenic
1038172431 8:25148492-25148514 CTCCATTGCTAGCTAGGGCAGGG + Intergenic
1038795116 8:30702975-30702997 CTCTCTTTGGAGCCAGGCCATGG - Intronic
1039131988 8:34275592-34275614 CCTCCTTGGGAACCAGGGCCAGG + Intergenic
1039531568 8:38267931-38267953 CGCCATTCAGAGCCAGGGCAAGG + Exonic
1040679902 8:49796174-49796196 CTCCCTTGGGGGCAGGGGCCAGG - Intergenic
1043885237 8:85591660-85591682 TTCTCTTGGGAGCCAGGGTGGGG - Intergenic
1047480010 8:125272925-125272947 CTGACTTGGGAGCTAGGCCAGGG + Intronic
1048350688 8:133613568-133613590 CTCCCTGGGGAGTCAGGGTTTGG - Intergenic
1048437936 8:134434944-134434966 CTCCTTGGGAAGACAGGGCAGGG - Intergenic
1048976318 8:139674871-139674893 GTCCCTGGGGTGCCAGGCCAGGG - Intronic
1048978949 8:139692795-139692817 CACTCATGGGTGCCAGGGCATGG - Intronic
1048984875 8:139730006-139730028 CTCCCTTGAGGGCCAGAGCTGGG - Intergenic
1049147826 8:141014652-141014674 CTCTCCTGGCAGCCAGGGCGTGG - Intergenic
1049202164 8:141345763-141345785 CCCTCTGGGGAGCCAAGGCAGGG - Intergenic
1049251270 8:141590517-141590539 CTCCCTCTGGACCCAGGGCTTGG + Intergenic
1049325615 8:142020016-142020038 CTCCCCTCGGGGCCGGGGCATGG + Intergenic
1049429098 8:142550952-142550974 GTGCCTTGGGAACCAGGGCAGGG + Intergenic
1049503999 8:142985225-142985247 CTCCCTTGCCAGGCAGGCCATGG - Intergenic
1049553964 8:143273231-143273253 CTCCCCTGGCTGCCAGGGGATGG + Intronic
1049799800 8:144512505-144512527 CTGCCTGAGGACCCAGGGCAAGG - Exonic
1049865772 8:144934496-144934518 CACCCTCTGGAGCCAGGGCTGGG - Intronic
1050993039 9:12175774-12175796 CTACATTGGGTGCTAGGGCAGGG + Intergenic
1052325920 9:27216713-27216735 CGTCCTTGGGATCTAGGGCAGGG + Intronic
1052940286 9:34127069-34127091 CAGCCCTTGGAGCCAGGGCACGG - Intronic
1055453973 9:76456119-76456141 CTGCTTTGTGAGCCAGGGCTGGG + Intronic
1056814313 9:89790465-89790487 CTCCCTGGGGAGTCGGGGCAGGG + Intergenic
1057552280 9:96060840-96060862 CACCCTTAGGGGCAAGGGCAGGG - Intergenic
1057890166 9:98863952-98863974 CTCTCTTGGGAGCCAGATCTGGG + Intergenic
1059528885 9:115017804-115017826 TCCCCTTGATAGCCAGGGCATGG - Intergenic
1060149836 9:121281601-121281623 TTCCCTGGGCAGCCAGGGCGGGG - Intronic
1060821743 9:126665292-126665314 CTCCCCCTGGAGCCAGGGCTGGG + Intronic
1061383199 9:130271785-130271807 CTCCCTTAGCTGACAGGGCAAGG + Intergenic
1061613757 9:131765838-131765860 CAGCCTTGGGGGCCAGGGCAAGG - Intergenic
1061649124 9:132032105-132032127 ATGCCATGGGAGCCTGGGCACGG + Intronic
1062014675 9:134285107-134285129 CTCCCTGGGGCCCCAGGACAAGG + Intergenic
1062250568 9:135591800-135591822 CTGCCTGGGGAGGGAGGGCAGGG - Intergenic
1062431881 9:136529997-136530019 GGGCCCTGGGAGCCAGGGCAGGG - Intronic
1062590676 9:137273114-137273136 CTGCCCTGGGAGCCACTGCATGG - Exonic
1185507295 X:640758-640780 CTCCCTGGGGAGGCTGGGCTGGG + Intronic
1187249538 X:17584300-17584322 TTCCCTGGGGAGGGAGGGCAGGG + Intronic
1189469498 X:41302700-41302722 CTCCTTTGAGGGCCAGGGTAGGG + Intergenic
1195807883 X:108795956-108795978 CTCCCATGTGAGCTAGGGCCTGG + Intergenic
1196456396 X:115894368-115894390 CTCCCTTGGGAGACTGGCCTTGG + Intergenic
1198925631 X:141788561-141788583 GTCGCTTGGGAGCTAGGGCCTGG + Intergenic
1199671613 X:150152522-150152544 CCTCCTTGGGACCCAGGGCTGGG + Intergenic
1200045846 X:153400806-153400828 CTCCCTGGGGTGGGAGGGCAAGG - Intergenic
1200066979 X:153508607-153508629 CACCCTTGGGAGCCAGGGAGAGG - Exonic
1200383521 X:155865383-155865405 CACCGCAGGGAGCCAGGGCAGGG + Intergenic
1201573583 Y:15438806-15438828 TTTCCTTGGGAGCCAGGAAAAGG - Intergenic