ID: 1119492634

View in Genome Browser
Species Human (GRCh38)
Location 14:75050265-75050287
Sequence GGTTAAGTATAGTCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119492634 Original CRISPR GGTTAAGTATAGTCACCTCA GGG Intronic
904591966 1:31619962-31619984 GGACATGTATAGTCACCTCCAGG + Intronic
908272016 1:62431397-62431419 GGTGAAGCATAGTCAGCTCCTGG - Intergenic
909009025 1:70311630-70311652 TGTTAACAATAGTCACCTCTGGG + Intronic
916996870 1:170310510-170310532 GCTTAAATATAGTCTCCTAAGGG - Intergenic
1068701015 10:60019538-60019560 TGTTAACTATAGTCACCCTACGG - Intergenic
1070361741 10:75697107-75697129 TGTTCAGCAGAGTCACCTCAAGG + Intronic
1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG + Intronic
1080390938 11:31845923-31845945 TGTTAACTATAGTCACCATATGG - Intronic
1080709587 11:34734173-34734195 GGTTAAGTAAAGTAAGCCCATGG + Intergenic
1088161607 11:106878490-106878512 TGTTAAGTATAATGACCTCCAGG - Intronic
1092596050 12:10005689-10005711 GGTCAGGTATATTCACCTGATGG + Intronic
1092701131 12:11232035-11232057 GTTAAAGTCTAGTCAACTCAAGG - Intergenic
1093412915 12:18887961-18887983 AGATACATATAGTCACCTCATGG + Intergenic
1093485521 12:19647930-19647952 GATTGAGTATGATCACCTCAGGG + Intronic
1106849747 13:33777126-33777148 GGACAAGTATTGTCACCTCTTGG + Intergenic
1107483633 13:40805688-40805710 GGGTAAGAATAGTTACCTCTAGG - Intronic
1108120464 13:47180422-47180444 TGTTAACTATAGTCACCCTATGG - Intergenic
1113842829 13:113370032-113370054 CCTTAAGGATGGTCACCTCAGGG + Intergenic
1116900295 14:50356081-50356103 GGGTAAGTATACTAACCTAAGGG + Intronic
1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG + Intergenic
1118742078 14:68746992-68747014 GTTTATGTAAAGTTACCTCACGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1127806578 15:62526553-62526575 GGTTAGTTACAGTCATCTCAGGG + Intronic
1131284086 15:91043288-91043310 GGTTAAACATAGTCCCCACAGGG + Intergenic
1137870063 16:51941246-51941268 TGTTAATTATAGTCACCCTATGG - Intergenic
1139189956 16:64850944-64850966 TGTTAACTATAGTCACCCTATGG - Intergenic
1141076911 16:81015040-81015062 GGTGAATTATTTTCACCTCAAGG + Intronic
1146396366 17:32470867-32470889 TGTTAAGTATAGAGGCCTCAAGG - Intronic
1155472626 18:26206778-26206800 GGTTAACTCAAGTGACCTCAAGG + Intergenic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1165641642 19:37393925-37393947 AGTGAAGTATCGCCACCTCATGG - Intergenic
1168184776 19:54692822-54692844 TGTTAACTATAGTCACCCTACGG - Intronic
926267117 2:11333917-11333939 GGTGAAGTAAAGATACCTCATGG - Intronic
929174765 2:38965211-38965233 CTTAAATTATAGTCACCTCAAGG + Intronic
930686040 2:54309209-54309231 GGTTAAGTATACATACCACATGG - Intergenic
933478048 2:82817789-82817811 GGTTAAGTATTGACATCTGAAGG - Intergenic
940007374 2:149020376-149020398 TGCTTAGTTTAGTCACCTCAAGG - Intronic
942794448 2:179800985-179801007 GCTTCAAAATAGTCACCTCAGGG + Intronic
944638086 2:201694141-201694163 GGTTAAGAGTAGGCACCACAGGG - Intronic
1183400672 22:37602082-37602104 GCTTATGTAGATTCACCTCAAGG - Intergenic
960261231 3:115570847-115570869 TGTTAACTATAGTCATCTTAAGG - Intergenic
963712142 3:148758163-148758185 GCTTAACTATATTTACCTCAGGG - Intergenic
965318882 3:167226783-167226805 GGTTAAGTAAAGACACATGATGG - Intergenic
970173804 4:13316114-13316136 TGTTAACTATAGTCACTCCAAGG + Intergenic
970881194 4:20933994-20934016 GGTAAAGTTATGTCACCTCAAGG + Intronic
972336363 4:38110294-38110316 GGTCAAGAATGGTGACCTCAGGG - Intronic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
976121348 4:81785953-81785975 GGATAATCATAGCCACCTCATGG - Intronic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
977327951 4:95601118-95601140 GGGTAATAATATTCACCTCATGG + Intergenic
978228154 4:106363964-106363986 GATATAATATAGTCACCTCAAGG - Intergenic
980239259 4:130152329-130152351 TGTTAACTATAGTCATCTTATGG - Intergenic
981123390 4:141078183-141078205 GGTTAAGTACAGGCATCTCTTGG - Intronic
981907730 4:149941863-149941885 GGTTAAGAATAGTAATCTCTTGG + Intergenic
982731455 4:158959517-158959539 GGTATAGTATAGCCACCTCAGGG + Intronic
987690430 5:21259400-21259422 GCTTAAGTGTAGTCACCACTTGG - Intergenic
987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG + Intergenic
996537270 5:124591652-124591674 GGTGAAGCTTACTCACCTCAGGG + Intergenic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
1002523295 5:179803056-179803078 GGCAAAGTTCAGTCACCTCAGGG + Intronic
1015002451 6:128234950-128234972 TGTTAACTATAGTCACCCTATGG - Intronic
1017701290 6:157074835-157074857 GGTGAGGTATAGTAACATCATGG + Intronic
1024822176 7:53344764-53344786 GGTTTAGTTTTGTCAGCTCATGG + Intergenic
1028338475 7:89687929-89687951 TGTTAACTATAGTCAGCTCGTGG + Intergenic
1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG + Intronic
1031584658 7:123519736-123519758 TGTTAACTATAGTCACCGTACGG - Intronic
1032597337 7:133254691-133254713 GGTAAACTATACTCTCCTCAAGG - Intronic
1034621400 7:152460036-152460058 GGTTAAGTGTCATCCCCTCAGGG - Intergenic
1039687282 8:39817424-39817446 TGTTAACTATAGTCACCCTATGG - Intronic
1040105311 8:43538203-43538225 GGTTTAGTAAAACCACCTCAGGG - Intergenic
1051025889 9:12610293-12610315 AAATAATTATAGTCACCTCAAGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1057169574 9:92953260-92953282 GTGTAAGTATAGACACATCAGGG + Intronic
1062598008 9:137307730-137307752 GGCTGAGCACAGTCACCTCATGG + Intronic
1187672866 X:21685960-21685982 GGTTAGGGACAGCCACCTCAGGG - Intergenic
1190898379 X:54643671-54643693 TGTTAACTATAGTCACCCTATGG + Intergenic
1193609647 X:83614006-83614028 TGTTAACTATAGTCATCTTAGGG - Intergenic
1198718419 X:139588065-139588087 TATTAAGCAGAGTCACCTCATGG + Intronic