ID: 1119495171

View in Genome Browser
Species Human (GRCh38)
Location 14:75071630-75071652
Sequence GCACCGACTGGTGTTTCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119495171_1119495177 15 Left 1119495171 14:75071630-75071652 CCTTCAGAAACACCAGTCGGTGC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1119495177 14:75071668-75071690 CAGAAATTCCAGCCTGTCCATGG 0: 1
1: 1
2: 0
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119495171 Original CRISPR GCACCGACTGGTGTTTCTGA AGG (reversed) Exonic