ID: 1119495177

View in Genome Browser
Species Human (GRCh38)
Location 14:75071668-75071690
Sequence CAGAAATTCCAGCCTGTCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119495174_1119495177 3 Left 1119495174 14:75071642-75071664 CCAGTCGGTGCTTTGCAGGGATC 0: 1
1: 0
2: 1
3: 7
4: 74
Right 1119495177 14:75071668-75071690 CAGAAATTCCAGCCTGTCCATGG 0: 1
1: 1
2: 0
3: 21
4: 215
1119495168_1119495177 19 Left 1119495168 14:75071626-75071648 CCCGCCTTCAGAAACACCAGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1119495177 14:75071668-75071690 CAGAAATTCCAGCCTGTCCATGG 0: 1
1: 1
2: 0
3: 21
4: 215
1119495169_1119495177 18 Left 1119495169 14:75071627-75071649 CCGCCTTCAGAAACACCAGTCGG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1119495177 14:75071668-75071690 CAGAAATTCCAGCCTGTCCATGG 0: 1
1: 1
2: 0
3: 21
4: 215
1119495167_1119495177 20 Left 1119495167 14:75071625-75071647 CCCCGCCTTCAGAAACACCAGTC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1119495177 14:75071668-75071690 CAGAAATTCCAGCCTGTCCATGG 0: 1
1: 1
2: 0
3: 21
4: 215
1119495171_1119495177 15 Left 1119495171 14:75071630-75071652 CCTTCAGAAACACCAGTCGGTGC 0: 1
1: 0
2: 0
3: 1
4: 90
Right 1119495177 14:75071668-75071690 CAGAAATTCCAGCCTGTCCATGG 0: 1
1: 1
2: 0
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119495177 Original CRISPR CAGAAATTCCAGCCTGTCCA TGG Exonic