ID: 1119499504

View in Genome Browser
Species Human (GRCh38)
Location 14:75112005-75112027
Sequence GTGCACAAAACATAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119499500_1119499504 6 Left 1119499500 14:75111976-75111998 CCAGACCAAAAGGGTGATACTGC 0: 1
1: 0
2: 0
3: 78
4: 2391
Right 1119499504 14:75112005-75112027 GTGCACAAAACATAAATGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 242
1119499501_1119499504 1 Left 1119499501 14:75111981-75112003 CCAAAAGGGTGATACTGCCTGCA 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1119499504 14:75112005-75112027 GTGCACAAAACATAAATGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119499504 Original CRISPR GTGCACAAAACATAAATGGA AGG Intronic
900333260 1:2147408-2147430 GTGGACAACAGATAGATGGAAGG - Intronic
903600193 1:24532526-24532548 CTGCATAAAAAATAAATGGATGG - Intronic
905368650 1:37470691-37470713 GCGCTCAAAACACAAAAGGATGG - Intergenic
905851524 1:41278428-41278450 GTGCTGAGCACATAAATGGATGG + Intergenic
907063273 1:51452539-51452561 GTGCTCAATAAATAAATTGAGGG - Intronic
908571587 1:65417027-65417049 GTGCACACAAGATAAATGCCAGG - Intergenic
908686950 1:66731237-66731259 GTGCACAACCAAAAAATGGAGGG - Intronic
909263438 1:73525589-73525611 GTGAATAAAACATAAATAAAAGG + Intergenic
911803796 1:102179213-102179235 AGGCACAAAACAAAATTGGATGG + Intergenic
911854343 1:102858014-102858036 GAGCACAGAACCAAAATGGAAGG + Intergenic
912930718 1:113957788-113957810 CTGCACAAAAAATTACTGGATGG - Intronic
914758840 1:150582407-150582429 CTGCCCAAAACATAAATGGGTGG - Intergenic
915058952 1:153163714-153163736 GTGCACAGAAGTTACATGGATGG - Intergenic
916994966 1:170286746-170286768 GTGCTCAACACACAAATGGATGG - Intergenic
919278760 1:195457367-195457389 GTGAAAATAAGATAAATGGAAGG - Intergenic
919287067 1:195577616-195577638 GTACACAAAACAATAATGAATGG - Intergenic
919444441 1:197684535-197684557 GTGTATAAAAAATAAAGGGATGG + Intronic
919636186 1:200005869-200005891 GTGCACCAAACACAAATTCAAGG - Intergenic
921449042 1:215281461-215281483 TTTAAAAAAACATAAATGGATGG - Intergenic
922521862 1:226260128-226260150 TTGCACAAGAAAAAAATGGAAGG + Intronic
924395479 1:243615183-243615205 GTGCTCAAAACATATATTGAAGG - Intronic
1062990785 10:1813926-1813948 GTTAACAAAATAAAAATGGAAGG + Intergenic
1064424701 10:15220454-15220476 ATGCACATATCCTAAATGGAGGG + Intronic
1065801233 10:29354825-29354847 GTACACAAATCATAAATGTATGG + Intergenic
1068238537 10:54271769-54271791 GTTCCCAAAACCTAACTGGAAGG + Intronic
1068322672 10:55440143-55440165 GTGAACAAAAAATAAACTGAGGG + Intronic
1068337250 10:55650627-55650649 GTGCACAAATTATAAATATACGG - Intergenic
1068343195 10:55735982-55736004 TTGCACAAGACATAACTGAAAGG + Intergenic
1071985707 10:91048124-91048146 TAGCACAATACATAAATGAATGG + Intergenic
1073836258 10:107446565-107446587 GGGCAAAAGATATAAATGGATGG + Intergenic
1074103008 10:110368394-110368416 ATCCAGAAAACAAAAATGGATGG + Intergenic
1076326160 10:129624539-129624561 GAAAACAAAACAGAAATGGAGGG + Intronic
1077304102 11:1860497-1860519 ATGAACAAAAAATAGATGGATGG + Intronic
1078356978 11:10639727-10639749 CTGCACAAAAAATAACTGGATGG - Intronic
1078583956 11:12564354-12564376 GTTCACAAAACATATATAAAAGG + Intergenic
1081385394 11:42466304-42466326 GTACACAAAACATTAGTGCATGG + Intergenic
1082715811 11:56612058-56612080 GTGCAAAAAATATAAATATATGG - Intergenic
1083442485 11:62686443-62686465 ATGCAATAAACACAAATGGAGGG + Exonic
1084605903 11:70171475-70171497 GTTCACAAAAGAGAAAAGGAAGG + Intronic
1086591386 11:88518961-88518983 GGCCACAAAACAAAAATGTATGG - Intronic
1087308752 11:96515515-96515537 GTGCACAAAATATCTGTGGAAGG - Intergenic
1087343008 11:96932930-96932952 GTGAAAGAAAAATAAATGGAAGG - Intergenic
1087914286 11:103790847-103790869 TTTTACAAAACATAAAAGGAAGG + Intergenic
1088495998 11:110431498-110431520 GTTCACACAACAAAAATGTATGG - Intronic
1088783192 11:113155962-113155984 GTGCACAAAAGATTGGTGGAGGG + Intronic
1088875828 11:113935572-113935594 GTGCACAGAGCAGAAATGCATGG - Intronic
1089006462 11:115095492-115095514 GTGCTCAAAAAATAAAAGGATGG + Intergenic
1089748829 11:120635823-120635845 ATGCACAAATCATAAGTGTATGG + Intronic
1093656293 12:21698202-21698224 GTGAACAAAACGTGCATGGAGGG + Intronic
1094260276 12:28488982-28489004 GTGGACAATACAAAAATGAATGG - Intronic
1094758961 12:33506378-33506400 ATGCATAAAAGATAAATAGAAGG + Intergenic
1098044972 12:66391040-66391062 GAACAAAAAACAAAAATGGAAGG - Intronic
1098632131 12:72737081-72737103 GTTCAGAAAAGAAAAATGGATGG + Intergenic
1098871174 12:75818856-75818878 GTGAACAAAGAATAAAAGGAGGG - Intergenic
1099321067 12:81149499-81149521 GTGCAGAAAAAAGAAATGCATGG - Intronic
1100118513 12:91340160-91340182 GTGAACAAAACATATATAGGTGG + Intergenic
1100291843 12:93222957-93222979 GTGCACAATATATTAATTGAGGG + Intergenic
1101762324 12:107669086-107669108 GAGCACAAAATATAAAGGAATGG - Intergenic
1102760173 12:115377915-115377937 GTGCACAAATCATAAATGTTCGG + Intergenic
1102859643 12:116324404-116324426 GTCCACAATACTTAAATGAAGGG + Intergenic
1104779350 12:131409933-131409955 GTGGATAAGTCATAAATGGATGG - Intergenic
1106656346 13:31751381-31751403 GAGCACAGAACATAGATGGAAGG + Intronic
1106696114 13:32174961-32174983 GTGAATAATACATAAATGAATGG - Intronic
1107777165 13:43856891-43856913 GTACACAAATTATAAATGGATGG - Intronic
1109691695 13:65901307-65901329 AAGCACAAAAAATAAAAGGAAGG - Intergenic
1110137564 13:72086823-72086845 TTGCACAAAACAAAGATGAATGG + Intergenic
1110148829 13:72225736-72225758 TTGCACAAAACAAAGATGAATGG - Intergenic
1110503112 13:76252370-76252392 GTACTCAAATTATAAATGGATGG - Intergenic
1111486722 13:88911130-88911152 GTGTGTAAAACATAAATGTATGG - Intergenic
1116652739 14:47614482-47614504 GTGGAAATAACATTAATGGAAGG - Intronic
1116776368 14:49186176-49186198 ATGCACAAAAGATAAAGAGAAGG - Intergenic
1117096823 14:52307077-52307099 ATGCACAGAAGAAAAATGGAAGG + Intergenic
1117775228 14:59177246-59177268 GTGCTGGAAAAATAAATGGATGG + Intergenic
1119499504 14:75112005-75112027 GTGCACAAAACATAAATGGAAGG + Intronic
1120072330 14:80117598-80117620 TTGTTCAAAACCTAAATGGAAGG + Intergenic
1120881843 14:89419723-89419745 ATGCACAAAACATCAAGGGAGGG - Intronic
1121872867 14:97425625-97425647 ATGCTTAAAACATAAATGAATGG - Intergenic
1122681086 14:103463718-103463740 GTGTAGAAAACATACATGGGAGG - Intronic
1124221928 15:27856839-27856861 TTGGAAAAATCATAAATGGATGG + Intronic
1127595972 15:60482443-60482465 GTTCACAAAACAGAAAAGAAAGG - Intergenic
1128842512 15:70861698-70861720 CTCCACAAGACATAAATGGCAGG - Intronic
1128954957 15:71930828-71930850 ATACACAAAAGATAAAAGGATGG - Intronic
1129613387 15:77079220-77079242 GTACACAAACCATAAATGCATGG + Intronic
1130246583 15:82256069-82256091 TTGGAGAAAACTTAAATGGAAGG - Intronic
1131796412 15:96021792-96021814 GTGCAGAAGACATGAATTGAAGG + Intergenic
1134515886 16:14886568-14886590 GTGCATGATACATAACTGGATGG + Intronic
1134703559 16:16285212-16285234 GTGCATGATACATAACTGGATGG + Intronic
1134963984 16:18426902-18426924 GTGCATGATACATAACTGGATGG - Intronic
1134968271 16:18509438-18509460 GTGCATGATACATAACTGGATGG - Intronic
1135422502 16:22314539-22314561 CTTTACAAACCATAAATGGAAGG - Intronic
1135842750 16:25891572-25891594 GAGAACAACACAGAAATGGATGG + Intronic
1136098750 16:27977861-27977883 GTTCAGAAAAGACAAATGGAAGG + Intronic
1137280425 16:46972790-46972812 GTACAGTAAACATAAATAGAAGG - Intronic
1138300380 16:55921662-55921684 GTGCAAAAAAAAAAAATTGAAGG + Intronic
1138664534 16:58553997-58554019 GTGAAGAAAACAAAAATAGAAGG + Intronic
1139334671 16:66223464-66223486 GTGCTAAAAACATAAATGTGGGG + Intergenic
1141580776 16:84997066-84997088 GAGCACAAAACAGAAATGAAGGG + Intronic
1146567561 17:33926206-33926228 GTGCTCAAAACATAAAAATAGGG - Intronic
1146815399 17:35938121-35938143 GTGCAAAACACATGAATAGATGG - Intronic
1150461208 17:65355227-65355249 GTGTACAAAGCAAAAATGTATGG - Intergenic
1154312577 18:13278782-13278804 CTGAAGAAAAAATAAATGGAAGG - Intronic
1155647155 18:28092900-28092922 GAGCACAAAATGTAAATGTAGGG - Intronic
1156580875 18:38373641-38373663 GTGGACAAATCACAAATGAATGG + Intergenic
1157373592 18:47141713-47141735 GTGCTCAAAAAACAAAAGGATGG - Intronic
1162861436 19:13508098-13508120 ATGCATAAAACATAAAGGTACGG + Intronic
1164884723 19:31768856-31768878 GTGCACATGAAATAAATGGCTGG + Intergenic
926962918 2:18378556-18378578 GTGGACCAAAGAGAAATGGATGG - Intergenic
927445893 2:23161286-23161308 ATGCACCAAACATAAATAGAGGG - Intergenic
927457872 2:23272895-23272917 GTTCTCTAAACATAACTGGAGGG - Intergenic
932394800 2:71435516-71435538 GGGCACAAAAAATAATTGAATGG + Intergenic
933031654 2:77335950-77335972 GTACACAATACAAAAATGAATGG + Intronic
933565033 2:83939894-83939916 GTCCACAAAACATAAATCCTGGG - Intergenic
934538249 2:95154677-95154699 GTTTGCAAAACAAAAATGGAAGG + Intronic
936418329 2:112340211-112340233 GTGTACTAAAGATAAATTGAAGG - Intergenic
938390369 2:130900351-130900373 CTACATAAAACAAAAATGGATGG - Intronic
939693954 2:145300631-145300653 TTGTACAAAATATAAATGTAAGG + Intergenic
940577004 2:155521554-155521576 ATGAACAAAATTTAAATGGAGGG + Intergenic
941121521 2:161536093-161536115 ATGCACAAGACAAAAATAGAAGG + Intronic
942897691 2:181077110-181077132 ATTCACAAAACATAAAAAGACGG - Intergenic
946572651 2:221041624-221041646 GCTCACACAACATACATGGAGGG + Intergenic
946986296 2:225277639-225277661 GTGGTGAAAACAGAAATGGAAGG + Intergenic
947040640 2:225915485-225915507 GAGCACAAAGTAAAAATGGATGG - Intergenic
947479503 2:230485484-230485506 GTGTAGAAAACAGAAAAGGATGG - Intronic
947717251 2:232347705-232347727 GTGCAGAAAACAGAAAGGTATGG + Intergenic
948313650 2:237010035-237010057 GGGCAGAAAAGATAAATAGATGG + Intergenic
948708071 2:239807400-239807422 GAGCACAAGACGCAAATGGAAGG + Intergenic
1169824039 20:9746465-9746487 GTGCACAAATCTTAAGTGTATGG + Intronic
1169824230 20:9748634-9748656 GTGCACAAATCTTAAGTGTATGG + Intronic
1172262120 20:33576382-33576404 ATCCAAACAACATAAATGGAAGG - Intronic
1173681903 20:44888234-44888256 GTGAATAAATCACAAATGGATGG - Intronic
1177677248 21:24316582-24316604 ATGCAGAAAATATAAATGAATGG + Intergenic
1177809305 21:25908215-25908237 ATCCACAAAACCTAAATGAATGG - Intronic
1178587651 21:33883650-33883672 GAGCAGAAAGCATAAATGAAAGG + Exonic
1179289573 21:40006768-40006790 GGGTACAAAAAATAAATGGAGGG + Intergenic
1182045907 22:27273989-27274011 GTGCAGAAAATCTGAATGGAAGG - Intergenic
1182939992 22:34267582-34267604 ATGTACCAAACATAATTGGAAGG + Intergenic
1184480949 22:44746790-44746812 TTTCACAAAACACAAATGCAAGG + Intronic
1185262273 22:49874265-49874287 CTGCACAAACCAGGAATGGAAGG - Intronic
949739991 3:7221171-7221193 ATGCACATAACCTCAATGGAGGG - Intronic
949780595 3:7682600-7682622 AAGCAGAAAACATAATTGGAGGG + Intronic
951328375 3:21333753-21333775 TTGCACAAAATATAAAAGAAGGG + Intergenic
953784974 3:45904592-45904614 GTCCACAAGACCAAAATGGAAGG - Intronic
956381737 3:68671273-68671295 GTGCACAAAGCAAAAACTGATGG + Intergenic
956437549 3:69248280-69248302 GAGCACAAAACAGAACTGGTGGG + Intronic
956645427 3:71450844-71450866 GTGCCCAAAACATAAAATGTAGG - Intronic
956810292 3:72857931-72857953 GTGCACAAATCTTAAATCCATGG - Intronic
956932022 3:74054319-74054341 ATGGACAATACATAAATGAATGG - Intergenic
956941961 3:74173253-74173275 ATGCACAATACATAAATGGATGG + Intergenic
959564714 3:107822687-107822709 GTGTCTAAACCATAAATGGAAGG + Intergenic
960600361 3:119451317-119451339 TTTCCCAAAACATACATGGAAGG - Intronic
962799318 3:138876612-138876634 GACCACATAACAGAAATGGAAGG + Intergenic
963554125 3:146764749-146764771 TTGCATAAATGATAAATGGAAGG - Intergenic
963963842 3:151342557-151342579 GTGTACCAAGCATCAATGGAAGG - Intronic
964060716 3:152518833-152518855 GTGCACTAGACAACAATGGATGG - Intergenic
964215263 3:154273289-154273311 GTGCAGAAGACATAAATTGGAGG + Exonic
966437408 3:179904329-179904351 TAACACAAAACACAAATGGAAGG - Intronic
969419498 4:7083762-7083784 GTGGACAATATATAAATGAATGG + Intergenic
971632882 4:29017630-29017652 ATGGAGAAAATATAAATGGAAGG - Intergenic
973627437 4:52787128-52787150 ATGCATAAAAAATAACTGGAAGG + Intergenic
973937215 4:55858956-55858978 CTGCACAAAAGATACAGGGAAGG - Intronic
974450050 4:62042793-62042815 GTATACAAAACATAAGTGTATGG + Intronic
974712004 4:65609729-65609751 GTGCAGAAGCAATAAATGGAAGG + Intronic
975590865 4:75998570-75998592 GAGAACAAAACATACATAGATGG - Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
975926525 4:79461658-79461680 GTGCAAAATACAACAATGGAAGG + Intergenic
976111692 4:81681864-81681886 GTGCACACATCATAAATATAAGG - Intronic
976607928 4:86999970-86999992 GTGCTCGAAACACAAAAGGATGG + Intronic
977555808 4:98486502-98486524 ATGCACAAAACCTCCATGGATGG + Intronic
978945814 4:114494933-114494955 GTTCACACAACATTAATGAAAGG + Intergenic
982135906 4:152273905-152273927 GTGCACTTAGGATAAATGGAAGG - Intergenic
982996578 4:162356052-162356074 TTACAGAAAAAATAAATGGAAGG - Intergenic
984077615 4:175202959-175202981 GGGCACAAAACACAAATAAAAGG - Intergenic
984855347 4:184190332-184190354 AAGCACAAAGCAGAAATGGAAGG - Intronic
985681940 5:1260133-1260155 GTGCACATAACATGTATTGAGGG - Intronic
987398133 5:17445162-17445184 GAGCACTAAATGTAAATGGAGGG + Intergenic
989118052 5:37975983-37976005 GAGAACAAAGCAGAAATGGAAGG + Intergenic
989234139 5:39124986-39125008 GTGCACAGAACAGAAATGACTGG + Intronic
990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG + Intronic
991438970 5:66626268-66626290 GTGCACAAATGATAACTGTAGGG + Intronic
991481085 5:67080558-67080580 ATGTACAGAACATAAATGAAAGG + Intronic
991619831 5:68533958-68533980 GTGCATAACCCATAAATGTAAGG - Intergenic
992249221 5:74860780-74860802 CTGCACAATCCATAAATGCAGGG + Intronic
992853827 5:80839709-80839731 GTGCAAAAAATATATATAGAAGG - Intronic
992986797 5:82238656-82238678 GTGCTCCATAAATAAATGGATGG + Intronic
993452864 5:88094251-88094273 TTTCACAAAACACAAATAGATGG + Intergenic
993989186 5:94635571-94635593 ATACACAAAACATAAGTAGAAGG - Intronic
994981480 5:106880259-106880281 ATACACAATACATAAATGAATGG - Intergenic
996611494 5:125386099-125386121 CAGCACAAAATATAAAAGGATGG - Intergenic
996815373 5:127567886-127567908 CTTCACAAAAAATAAAAGGAAGG - Intergenic
996940769 5:129002581-129002603 GTTCACAACACATTTATGGAAGG - Intronic
1002117989 5:176979709-176979731 GTGCATAAAATATAAATGCATGG - Intronic
1004935094 6:20499739-20499761 GTACAGAAAATATAATTGGATGG + Intergenic
1004959293 6:20768534-20768556 GTACACCAAACAAAAATGCATGG - Intronic
1006967674 6:38005553-38005575 GTGCTCAAAACAGAGAGGGAAGG - Intronic
1006972491 6:38060907-38060929 ATGCAAAAATCATATATGGAAGG - Intronic
1007224612 6:40304118-40304140 GTAGACAAAACGTAAATGAACGG + Intergenic
1007254022 6:40516088-40516110 GCCCAGAAAACACAAATGGATGG - Intronic
1008606860 6:53149031-53149053 GTCCTCATAACATAAAGGGAGGG - Intergenic
1011402139 6:86975094-86975116 GTGCACAAAACTTAAAATCATGG + Intronic
1012517177 6:100075869-100075891 ATGAGCAAAACATAGATGGATGG - Intergenic
1014200068 6:118599277-118599299 GTGCTCAAAAAACAAAAGGATGG + Intronic
1014282213 6:119454310-119454332 GAGCACAATTCATAGATGGAGGG + Intergenic
1014321059 6:119928286-119928308 TTGGACAAAACAAAAATGTAGGG + Intergenic
1015254214 6:131159821-131159843 GTAGACAAAACATAAATGAGTGG - Intronic
1015854495 6:137608836-137608858 GTGAACAAAAAATAACTGGAGGG - Intergenic
1016191192 6:141267214-141267236 GTAAACAAAACATAAATATATGG + Intergenic
1016486930 6:144551253-144551275 GTTCACAAAACATAAAAACAAGG - Intronic
1016593691 6:145774896-145774918 GTGCTTAAAACCTAGATGGAGGG - Intergenic
1017517266 6:155167790-155167812 GTTCACAAAACATAAGTGCTCGG - Intronic
1018517318 6:164598736-164598758 GTGCAATAAAGATAAATGTAAGG + Intergenic
1019773526 7:2898476-2898498 GTGCCCAAAGCAAAAATGGAGGG - Intergenic
1020068421 7:5208433-5208455 AAGCAAAAACCATAAATGGAAGG - Intronic
1020455245 7:8365770-8365792 GTCCAGAAAACATAAAATGATGG + Intergenic
1021075510 7:16299261-16299283 GAGTACAAGTCATAAATGGAAGG + Intronic
1021869617 7:24991554-24991576 GTGCAGAAAAAATGAATGGCAGG - Intergenic
1022876169 7:34532920-34532942 GTGCATAAATAATAAAAGGATGG + Intergenic
1026295441 7:69047968-69047990 GTGTACCAAACCTACATGGAAGG - Intergenic
1027722775 7:81766373-81766395 GTACACAAATAATTAATGGAAGG + Intronic
1028533575 7:91865488-91865510 CTACACAAAACATACATGCATGG + Intronic
1028935649 7:96461125-96461147 ATGCACAAAATAAAAATGGTTGG - Intergenic
1030731186 7:112991130-112991152 ATGCACAAAAAATAAATGAAAGG + Intergenic
1031803979 7:126285206-126285228 ATGCCCAATAAATAAATGGATGG + Intergenic
1034943237 7:155245387-155245409 GTGTCCAAAGCTTAAATGGACGG - Intergenic
1035844847 8:2852337-2852359 GTGCTCAAAAAATAAAGGGATGG + Intergenic
1038123954 8:24650032-24650054 GTACATAAAATATAAATGCATGG + Intergenic
1038751741 8:30302406-30302428 CTGCACAAATCATAAGTGAATGG - Intergenic
1038957634 8:32484370-32484392 GTGCACAAAACATGAGAGAAGGG + Intronic
1040628501 8:49180026-49180048 GGGCACAAAAAATAATTAGAAGG + Intergenic
1041303657 8:56438396-56438418 GTCCACAAAACATGACTCGAGGG - Intronic
1041416446 8:57615096-57615118 GTGCAAATAACATACATTGAGGG + Intergenic
1042667693 8:71224325-71224347 TTTTACAAAACAAAAATGGAAGG + Intronic
1042769492 8:72364475-72364497 GTGCACCATCCATAAATTGAGGG - Intergenic
1043596802 8:81897073-81897095 GTCCTCAAGACATAAATGCATGG - Intergenic
1044072135 8:87775249-87775271 GTGCACAAATCACAAATGAAGGG - Intergenic
1046372500 8:113327845-113327867 CTGGTCAAAACATAAAAGGAAGG + Intronic
1047000455 8:120567831-120567853 ATGCACAAATCATAAAGGTATGG - Intronic
1047198511 8:122743504-122743526 GTGCAAAAAAAAAAAAAGGAGGG + Intergenic
1047559179 8:125967828-125967850 GTGCTCAAAACAAAAATGATGGG - Intergenic
1048229731 8:132626440-132626462 GTCCACAAAACATGAATAAAAGG - Intronic
1049992662 9:1004438-1004460 GTGCATAAAATATATCTGGAAGG - Intergenic
1050188361 9:2998728-2998750 GTCCACAAGACGTAACTGGATGG - Intergenic
1051435362 9:17024918-17024940 GTGCACAAATCATAAGTGTGGGG - Intergenic
1051834329 9:21318081-21318103 TAGCACAAAACATAGAGGGAGGG + Intergenic
1051970693 9:22883981-22884003 GTGTACAAAAACTTAATGGAAGG + Intergenic
1052266079 9:26575267-26575289 ATACACCAAAAATAAATGGAAGG + Intergenic
1052401194 9:28002259-28002281 GGGAACAAAAAAAAAATGGAGGG - Intronic
1055385334 9:75755988-75756010 GTGCACAAATCATAAGTGGGAGG + Intergenic
1055597882 9:77884004-77884026 GCCCTCAAAACAGAAATGGAGGG + Intronic
1056806358 9:89732043-89732065 GTGCACAACAGATAAAGGCAGGG + Intergenic
1057239362 9:93394596-93394618 GTGTAGAAAACATAAATTGGAGG + Intergenic
1058438270 9:104984152-104984174 GTACAGAAACCAAAAATGGAGGG + Intergenic
1061165145 9:128917888-128917910 ACGCAGAAAACACAAATGGACGG - Exonic
1185470560 X:379692-379714 CTGAACAAAACCTAAATGAATGG + Intronic
1186707186 X:12153952-12153974 GTAGACAATACATAAATGAATGG - Intronic
1188010569 X:25051478-25051500 GTACACATATCATAAATGTACGG + Intergenic
1188504872 X:30871614-30871636 GGACACAGAATATAAATGGAGGG + Intronic
1189853267 X:45197858-45197880 GTGCACAAAACATAGCTACAGGG + Intronic
1190340164 X:49290091-49290113 GTGTATAAAACCTAAATGTATGG - Intronic
1191672617 X:63762547-63762569 GTGCAGGACACATAAATAGATGG + Intronic
1194489160 X:94525850-94525872 GTGCAAAGAACGTACATGGAAGG + Intergenic
1196294225 X:113980294-113980316 GAGAACAAAAGATAAAGGGAGGG - Intergenic
1196328293 X:114435287-114435309 ATGCACAAGACATAGTTGGAAGG + Intergenic
1196407151 X:115375574-115375596 GTGAAAAAAACATAAAGGGATGG + Intergenic
1197229870 X:123992181-123992203 GAGCACAAAAGCTAGATGGATGG - Intronic
1199794787 X:151183681-151183703 GTGCAGAAAACATAACTAAAAGG + Intergenic
1200270504 X:154678201-154678223 GAGCACAAAACAGGAGTGGACGG - Exonic
1202096948 Y:21261121-21261143 GTGCAAAAAATATCAATGTAAGG + Intergenic