ID: 1119500306

View in Genome Browser
Species Human (GRCh38)
Location 14:75121238-75121260
Sequence AGGTTTTTTTAGGTGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119500306 Original CRISPR AGGTTTTTTTAGGTGACACA AGG Intronic
900501442 1:3007249-3007271 TGGTTTTTTTATTTGCCACATGG - Intergenic
900839994 1:5041013-5041035 CTGTTTTTTTAGCTGACACAAGG + Intergenic
901605709 1:10457498-10457520 TGGTATTTTTAGTAGACACAGGG - Exonic
901922060 1:12544218-12544240 AGGTTTTTTTCTTTGAGACAAGG + Intergenic
902036313 1:13460790-13460812 AGGTTCTTTCAGGTGAAACAGGG - Intergenic
903125774 1:21246661-21246683 AGGTTTTTTTGTTTGAGACAGGG + Intronic
903692075 1:25181482-25181504 AGGTATTTTTAGTAGAGACAGGG + Intergenic
904234837 1:29108727-29108749 TTGTTTTTTTAGTAGACACAGGG + Intronic
906969058 1:50491149-50491171 AGGTTTTTTTTGGAGAGCCAGGG - Intronic
907579651 1:55560130-55560152 AGGTTTTTTTATCTGAAAAATGG + Intergenic
907749769 1:57251745-57251767 AGGTTTTGTTTGGTGAAAAAGGG - Intronic
908043203 1:60138131-60138153 AGGTTTTTGGTGGTCACACATGG - Intergenic
909330816 1:74408146-74408168 AGATTGTTTTATGTGACATAAGG - Intronic
910298795 1:85682196-85682218 TGGTATTTTTAGTAGACACAGGG + Intronic
910531540 1:88241785-88241807 ATGTTTTTTTAGTAGAGACAGGG - Intergenic
911907978 1:103594015-103594037 AGGTTTTTTAAGGTGCCATCTGG + Intergenic
912276590 1:108264585-108264607 ACATTTTTTTTGGTGTCACATGG + Intergenic
912291638 1:108429772-108429794 ACATTTTTTTTGGTGTCACATGG - Intronic
915525200 1:156471811-156471833 AGGTGTTTTCAGGTGACCCTAGG - Intronic
918790283 1:188816274-188816296 TGGTTTGTTCAGGTGACAGAGGG - Intergenic
919006241 1:191902532-191902554 TTGTATTTTTAGGAGACACAGGG + Intergenic
919402474 1:197136977-197136999 GGGTTTTTTTAGGGCACAGAAGG - Intronic
921086892 1:211802188-211802210 AGCATTTTTTATGTGGCACAGGG - Intronic
921100793 1:211927609-211927631 AGGTTTCTTTAGGAGAAACTAGG + Intergenic
922340267 1:224649220-224649242 AGGTCTTTATAGGTGGCAGAGGG + Intronic
924131725 1:240916088-240916110 TGGTATTTTTAGTAGACACAGGG - Intronic
1063142267 10:3265726-3265748 AGTTTTATTTAGTGGACACAGGG + Intergenic
1063595256 10:7429337-7429359 ATGTTTCTTTAGATGACACAGGG - Intergenic
1064115739 10:12575826-12575848 AGGTTGGTTTAGGTAACACTAGG - Intronic
1065004922 10:21370758-21370780 ATTTTTTTTTAGTAGACACAGGG - Intergenic
1065213782 10:23430322-23430344 AGGTTTTTTTTGTAGAGACAGGG + Intergenic
1065348653 10:24774591-24774613 ATTTTTGTTTAGGTGACATATGG - Intergenic
1065377847 10:25061017-25061039 ATGTTTCTTTAGATGAGACAAGG + Intronic
1068041522 10:51831139-51831161 AGGTATATTTAAGAGACACAAGG + Intronic
1070200875 10:74204864-74204886 TGGTATTTTTAGTAGACACAGGG - Intronic
1071272266 10:84019142-84019164 ATGTTTTTTTGGTAGACACAGGG - Intergenic
1072854969 10:98936804-98936826 TTGTATTTTTAGGGGACACAGGG - Intronic
1073556085 10:104453137-104453159 AGGTTATTTAAGGTGAGAGAGGG + Intronic
1074099729 10:110345353-110345375 ATGTTTTTTTCAGTTACACAGGG + Intergenic
1074134258 10:110613254-110613276 AGGGTTTTTAAGGAGACACTTGG + Intergenic
1077768185 11:5184482-5184504 TTGTTTTTTGAGGTGGCACAGGG + Intronic
1079120656 11:17682211-17682233 TGGTTTTTTTAGTAGAGACAGGG - Intergenic
1079220907 11:18560231-18560253 AGGATTAATTATGTGACACAGGG + Intronic
1081265452 11:41015484-41015506 CTGTATTTTTAGGAGACACAGGG + Intronic
1081510630 11:43769110-43769132 TTGTATTTTTAGGAGACACAGGG + Intronic
1082044314 11:47712729-47712751 TGGTATTTTTAGTAGACACAGGG - Intronic
1083231173 11:61320890-61320912 TTTTTTTTTTTGGTGACACAAGG + Intronic
1084519765 11:69656072-69656094 AGGTTTTTTAAGATGAAAGAGGG + Intronic
1087137331 11:94734231-94734253 TGATTTTTTTAGGTGAGATATGG + Intronic
1088322830 11:108571021-108571043 AGGTGTTATAAGCTGACACATGG + Intronic
1088525410 11:110748030-110748052 TTTTTTTTTTAGGTGACAGAAGG - Intergenic
1088862156 11:113810845-113810867 ATGTATTTTTAGTAGACACAGGG + Intronic
1089482718 11:118820294-118820316 TGGTTTTTTTAGTAGAGACAGGG + Intergenic
1089544559 11:119213188-119213210 AGGTGCTTTTAGGAGGCACAGGG - Intronic
1090001449 11:122963387-122963409 AAGTTATTTTAGATGCCACATGG - Intergenic
1095052094 12:37563497-37563519 TTGTATTTTTAGTTGACACAGGG - Intergenic
1095747180 12:45672819-45672841 TTGTATTTTTAGTTGACACAGGG - Intergenic
1096149566 12:49300262-49300284 AAGTTTTTTTAGTAGAGACAGGG + Intergenic
1096293647 12:50364378-50364400 ATTTTTTTTTAGGAGAGACAGGG - Intronic
1099413932 12:82363701-82363723 AGTTTTTTTTAGTTGAAAAATGG - Intronic
1099582399 12:84466762-84466784 AGGTTTTTTAATATGACAGAGGG + Intergenic
1100419178 12:94413544-94413566 AGGGTCTTTTACTTGACACAAGG + Intronic
1100945551 12:99778921-99778943 AGGTTTTATTAGGTGTCAGTTGG - Intronic
1100968130 12:100035631-100035653 TGGTATTTTTAGTAGACACAGGG - Intronic
1102670314 12:114612672-114612694 AGCTTTATTAATGTGACACATGG - Intergenic
1103172844 12:118836337-118836359 AGGCTTTTTTAGGAAACTCATGG - Intergenic
1103578360 12:121895708-121895730 AGGTCTTTATAGGTGAAAGAGGG - Intronic
1105773643 13:23636622-23636644 AGGTTTATTAAGGTGACCCTAGG + Intronic
1106431929 13:29688977-29688999 AGGTTCTTACAGGTGACAGAGGG + Intergenic
1107041341 13:35951184-35951206 CGGTTTTTTTAGTTGGGACATGG + Intronic
1107581783 13:41797212-41797234 TGGTATTTTTAGTAGACACAGGG + Intronic
1107687860 13:42922281-42922303 ATGTTTCTTTATGTGACAAAAGG + Intronic
1107690531 13:42948478-42948500 TTGTTTTTTTCGGTGAGACAAGG + Intronic
1107819289 13:44271812-44271834 AGATTTTTTTGAGTGCCACAGGG - Intergenic
1109264545 13:60182538-60182560 AGGTTTTTTTTATTGAGACAGGG + Intergenic
1109425909 13:62166240-62166262 AGCCTTTTTTAGGTGTCAAAAGG - Intergenic
1111703182 13:91716247-91716269 TTGTTTTTTTAGGTGAGATATGG + Intronic
1111984471 13:95051837-95051859 TGGTATTTTTAGTAGACACAGGG + Intronic
1112826030 13:103393428-103393450 AGGTTTGTTAAGGAAACACAGGG + Intergenic
1113351802 13:109536505-109536527 TGGTATTTTTAGTAGACACAGGG - Intergenic
1114997759 14:28378299-28378321 AGGTTTTTTGAGGTAGCATATGG - Intergenic
1115431306 14:33321786-33321808 AGGTGTTTTTATGTAACACAAGG + Intronic
1115657504 14:35458184-35458206 ATTTTTTTTTAGTGGACACAGGG + Intergenic
1115986780 14:39110502-39110524 TTGTATTTTTAGGAGACACAGGG - Intergenic
1118305823 14:64654439-64654461 GTGTGTTTTTAGGTGACTCATGG + Intergenic
1119414164 14:74458443-74458465 ATTTTTTTTTAGTAGACACAGGG - Intergenic
1119500306 14:75121238-75121260 AGGTTTTTTTAGGTGACACAAGG + Intronic
1202839196 14_GL000009v2_random:105215-105237 TGGTATTTTTAGTTGAGACAGGG - Intergenic
1202908578 14_GL000194v1_random:95368-95390 TGGTATTTTTAGTTGAGACAGGG - Intergenic
1123419379 15:20118985-20119007 ATTTTTTTTTAGTTGAGACAGGG - Intergenic
1123446484 15:20334515-20334537 ATTTTTTTTTAGTTGAGACAGGG + Intergenic
1123528601 15:21125527-21125549 ATTTTTTTTTAGTTGAGACAGGG - Intergenic
1125269151 15:37919189-37919211 TGGTATTTTTAGTTGAGACAGGG + Intergenic
1126165957 15:45653947-45653969 TGGTATTTTTAGTTGACACAGGG - Intronic
1127422901 15:58825776-58825798 TTGTATTTTTAGGTGAGACAGGG + Intronic
1127761381 15:62142913-62142935 AAGTTTTTAAAGGTGACACCAGG - Intergenic
1128020355 15:64385060-64385082 AGGTTTTTTTTGTAGAGACAGGG + Intronic
1128100431 15:64994258-64994280 TGGTATTTTTAGGAGAGACAGGG - Intergenic
1129015643 15:72466047-72466069 ATGTATTTTTAGTAGACACAGGG - Intergenic
1130925423 15:88382171-88382193 AGGATTTTTTAAGTGACACGTGG + Intergenic
1131000467 15:88935985-88936007 AGGTTTCTTTAGGAAAGACAAGG - Intergenic
1131138803 15:89960524-89960546 AGGTTTTTTTTTTTGAGACAGGG + Intergenic
1131670903 15:94618715-94618737 TCGTTTTTTTAGGAGAGACAGGG + Intergenic
1132169277 15:99631166-99631188 AGAATTTTTTAGGTGATATAAGG + Intronic
1133415452 16:5603467-5603489 AGGTTCTTTTTGGTGATGCAGGG + Intergenic
1133662348 16:7930637-7930659 GGGTTGTTTTAGGTGACAGAGGG + Intergenic
1133819017 16:9220209-9220231 CCCTTTTTTTAGGTGACAAAAGG - Intergenic
1134401944 16:13918396-13918418 AGGTTGTTTTATGTGGCAAAGGG - Intergenic
1135986135 16:27185768-27185790 AGGTAATTTTAGTTGATACAGGG - Intergenic
1136497582 16:30653507-30653529 AGGCTTTTTAAGATGCCACAAGG - Intronic
1137945926 16:52733213-52733235 TTGTTTTTTTAGGAGAGACAGGG - Intergenic
1138149144 16:54639117-54639139 AGTGATTTTTAGGTGACACATGG - Intergenic
1139763405 16:69206169-69206191 AAGTTTTTTTAGTAGAGACAGGG + Intronic
1139781893 16:69358614-69358636 AGGTTTGTGTAAGTCACACAAGG - Intronic
1140364783 16:74372875-74372897 AATTTTTTTTAGTTGAGACAGGG + Intergenic
1141118888 16:81335442-81335464 ATGTATTTTTAGTAGACACAGGG - Intronic
1142599358 17:1046041-1046063 TTGTTTTTTTAGTAGACACAGGG + Intronic
1143857030 17:9859616-9859638 ATTTTTTTTTAGTAGACACAGGG - Intronic
1144129694 17:12234292-12234314 AGGCTGTTTTAGGTGAGATAGGG + Intergenic
1144517035 17:15925793-15925815 TGGTTTTTTTAGTAGAGACAGGG - Intergenic
1145372596 17:22319417-22319439 TTGTATTTTTAGTTGACACAGGG - Intergenic
1145405919 17:22593609-22593631 AGGATGTATAAGGTGACACAAGG + Intergenic
1146780897 17:35671200-35671222 AGTTCTTTCTAGGTGACACCAGG - Intronic
1147707256 17:42434712-42434734 TGGTATTTTTAGTAGACACAAGG - Intergenic
1147789265 17:43003126-43003148 AGTATTTTTTAGGAGAGACAAGG - Intergenic
1148023250 17:44567647-44567669 TGGTTTTTTTAGTAGAGACAGGG + Intergenic
1150313573 17:64149605-64149627 TGGTATTTTTAGTTGAGACAGGG - Intronic
1150502341 17:65663400-65663422 AGATTTTTTTAGTCTACACATGG + Intronic
1151112886 17:71700427-71700449 AGGTTTTTCTGTGTGAAACAAGG - Intergenic
1151269828 17:72985583-72985605 TGGTATTTTTAGGAGAGACAGGG + Intronic
1155128294 18:22902415-22902437 AGGATATTTTAGCTGACACTTGG + Intronic
1156292335 18:35758735-35758757 ATATTTTTTTAACTGACACAGGG - Intergenic
1156403760 18:36764355-36764377 AGGCCTTTTTGGGTGCCACAAGG - Intronic
1156958732 18:42997009-42997031 AGATGTTTAAAGGTGACACAGGG - Intronic
1157332013 18:46710946-46710968 AGGTGTTTGTGCGTGACACAGGG - Intronic
1157602850 18:48904906-48904928 AGGGTTTTTTAGGGGCCACCAGG - Intergenic
1159047677 18:63384688-63384710 TGGTATTTTTAGTTGAGACAGGG - Intergenic
1159763736 18:72460391-72460413 AGATTTTTATGGGTGACAGAAGG - Intergenic
1161340966 19:3741999-3742021 GGGTTATTTTAGGGGACAGAAGG + Intronic
1162269457 19:9602191-9602213 TTGTATTTTTAGTTGACACAGGG - Intergenic
1163483814 19:17574645-17574667 AGTCTTTTTGAGGTGACACCTGG + Intronic
1163540574 19:17907034-17907056 ATGTTTTTTTAGTAGAGACAGGG + Intergenic
1163580179 19:18134371-18134393 AGGTTTTTTTTGTAGACATAAGG - Intronic
1163663533 19:18592449-18592471 AGGTTTTTTTGCTTGAGACAGGG + Intronic
1164253473 19:23506028-23506050 AGAATTTTTTATTTGACACAAGG + Intergenic
1164971322 19:32535157-32535179 AAGTTTTTTTTTTTGACACAGGG - Intergenic
1165054110 19:33162873-33162895 AGTTATTTTTATTTGACACAGGG - Intronic
1165588655 19:36945917-36945939 GCGTTTTTTTAGTTGAAACAGGG - Intronic
1165674565 19:37710290-37710312 TGGTTTTTTTAGTAGAGACAGGG - Intronic
1166216587 19:41339648-41339670 TGGTTTTTTTAGTAGACACTGGG - Intronic
1166719882 19:44990726-44990748 GGGATTTTTTGGGTCACACATGG + Intronic
1167433680 19:49466851-49466873 TTGTTTTTTTTTGTGACACAAGG - Intronic
1168244453 19:55104528-55104550 TGGTATTTTTAGGAGAGACACGG - Intronic
926033969 2:9619539-9619561 TGTTTTTTTTTGGTGAGACAAGG - Intronic
926431901 2:12795704-12795726 ATGTATTTTTAGTTGAGACAGGG - Intergenic
927594380 2:24383973-24383995 ATGTGTTTTTAGGAGAGACAGGG + Intergenic
929484867 2:42344073-42344095 ATTTTTTTTTAGGGTACACAAGG - Intronic
929558193 2:42938413-42938435 TTGTATTTTTAGGAGACACAAGG - Intergenic
930254569 2:49075810-49075832 GGGTTTTTTTGGGAGAGACAGGG + Intronic
930358942 2:50354007-50354029 AGGTTTTATTAACTAACACATGG + Intronic
930532979 2:52613613-52613635 AGGTTTGTCTAGGTAAAACAGGG - Intergenic
932637287 2:73401936-73401958 AGGTTTATTCATGTGACAAATGG + Intronic
932907680 2:75771141-75771163 TGGTTTTTTTAGTAGAGACAGGG - Intergenic
933238058 2:79886987-79887009 TGGTATTTTTAGTAGACACATGG + Intronic
936966367 2:118131221-118131243 AGGTTTTCCTAGGTGACAGATGG + Intergenic
937553390 2:123123678-123123700 AGGTTTTAATAGGTGAAAAAGGG + Intergenic
938645026 2:133321359-133321381 AGGTATTTTTAGGTAAAACCTGG - Intronic
939116089 2:138062452-138062474 AGATTTTTATAGGTGAGACCTGG + Intergenic
939527339 2:143313469-143313491 AAGTTGTCTGAGGTGACACAGGG - Intronic
940998787 2:160179563-160179585 TGGTATTTTTAGTTGAGACAGGG + Intronic
941673311 2:168318291-168318313 TGGTATTTTTAGTAGACACAGGG + Intergenic
942124582 2:172810704-172810726 AGTATGTTTTGGGTGACACATGG - Intronic
943655699 2:190506254-190506276 AGGTACTTTTAGGTGACAACAGG - Exonic
945024023 2:205603296-205603318 ACATTCTTTTTGGTGACACATGG - Intronic
945091417 2:206179501-206179523 AGGTATTTTTAGTAGAGACAGGG + Intronic
945427688 2:209726929-209726951 AGGTTTTTTTCCATGAAACAAGG + Intronic
946517591 2:220430047-220430069 AGGTGTTTGTAGGGGGCACATGG + Intergenic
947638970 2:231695443-231695465 TTGTATTTTTAGTTGACACAGGG + Intergenic
948146771 2:235714186-235714208 ATATTTTTTTAGTTGAGACAGGG + Intronic
948702768 2:239770558-239770580 AGCATTTTTCAGGTGACATAAGG - Intronic
949015691 2:241708791-241708813 GGATTTCTTTAGGTGACATAAGG + Intronic
1169994619 20:11543081-11543103 AGATTTTTTGTGGGGACACAAGG + Intergenic
1170279121 20:14625996-14626018 TGGTATTTTTAGTAGACACAGGG + Intronic
1170902295 20:20476641-20476663 AGGATTTTTTAGGGTACAAAAGG + Intronic
1171498333 20:25573760-25573782 AAGTCTTTTTAGTTGACTCAGGG - Intronic
1171546630 20:26007006-26007028 TTGTATTTTTAGTTGACACAGGG - Intergenic
1174325768 20:49777587-49777609 AGGTATTTTTAGGAGAGACGGGG + Intergenic
1177868847 21:26545946-26545968 GTGTTTTCTTAGGTGAGACATGG + Intronic
1180552528 22:16552277-16552299 ATTTTTTTTTAGTTGAGACAGGG + Intergenic
1181552288 22:23647341-23647363 ATGTTTTTTTAAGTGAAGCAAGG - Intergenic
1183925379 22:41202228-41202250 AATTTTTTTTAATTGACACAGGG + Intergenic
1184568124 22:45305544-45305566 AAATTTTTTTAGTTGAGACAGGG + Intergenic
1185239045 22:49731685-49731707 TGGTATTTTTAGGAGACACAGGG - Intergenic
953501874 3:43444235-43444257 ATGTGTTCTTTGGTGACACAGGG - Intronic
954685600 3:52368571-52368593 GGGATTTTTTTGGTGTCACATGG - Intronic
956658268 3:71574106-71574128 AGTTTTTTTTAAGTGCCTCAGGG + Intronic
959048322 3:101499365-101499387 AGGTTTTTTTAGGGGGCAGCGGG + Intronic
959210613 3:103375101-103375123 ATGTTTTATTAGGTGACAAAGGG - Intergenic
959522141 3:107332987-107333009 GGGTTTATTTAGGTGAGTCATGG + Intergenic
959539105 3:107520768-107520790 AGTTTCATTTAGTTGACACAAGG - Intergenic
959914116 3:111796697-111796719 TGGTATTTTTAGCTGAGACAGGG + Intronic
960576050 3:119230700-119230722 ATGTTTTTCTAGCTGTCACAGGG - Intronic
960971379 3:123142403-123142425 TGGATTATTTAGGTAACACATGG + Intronic
961263425 3:125620918-125620940 AGGTTTCTTTACCTGAAACAAGG - Intergenic
961844695 3:129751731-129751753 TTGTATTTTTAGGAGACACAGGG + Intronic
964758519 3:160111075-160111097 AGGTATTTTTAGTAGAGACAGGG + Intergenic
964959265 3:162403934-162403956 CTGTGTTTTTAGGAGACACAGGG + Intergenic
965965014 3:174478046-174478068 TGGTTTTTTAAGGTAACATATGG + Intronic
967084971 3:186086347-186086369 AGATTTTTCTATCTGACACAGGG + Intronic
967205601 3:187117918-187117940 AGATTTCATTAGGTGACAGATGG + Intergenic
967247898 3:187506249-187506271 TGGATTTTTTTGGTGCCACATGG - Intergenic
970597117 4:17610693-17610715 TTGTATTTTTAGGAGACACAGGG - Intergenic
970938294 4:21600957-21600979 AGATTTTTTTAAATGACAAAAGG - Intronic
971434390 4:26604699-26604721 ATGTATTTTTAGTAGACACAGGG - Intronic
971997633 4:33985898-33985920 AGGATGTATAAGGTGACACAAGG - Intergenic
972489926 4:39577598-39577620 TTGTATTTTTAGGAGACACAGGG + Intronic
973117053 4:46474818-46474840 AGATATTTTTTGCTGACACAGGG + Intronic
974171683 4:58274642-58274664 ATGTATTTTTAGTTGAGACAGGG - Intergenic
975702970 4:77084169-77084191 ATGTTTTTTTAGTAGAGACAGGG + Intergenic
978465702 4:109006410-109006432 TGGTATTTTTAGGAGAGACAGGG + Intronic
978791387 4:112666662-112666684 AGGTTTTTTTTTTTGAGACATGG + Intergenic
978808272 4:112822736-112822758 AGGTTTTTTTTTTTGAGACAGGG - Intronic
979036868 4:115731853-115731875 ATGTATTTTTAGTAGACACAGGG - Intergenic
979538316 4:121850009-121850031 AAGTTTTTTCAGATGACTCAGGG + Intronic
979958503 4:126987021-126987043 AGGTTTTTTTAGGTTGAACATGG + Intergenic
981330045 4:143497861-143497883 TGGTTTTTTTAGTGGAGACAGGG - Intergenic
982471432 4:155795695-155795717 TGGTTTTTTGATGTGAAACAAGG - Intronic
983494759 4:168430023-168430045 TGGTATTTTTAGTAGACACAGGG - Intronic
984089634 4:175356171-175356193 TTGTATTTTTAGGAGACACAGGG - Intergenic
985262021 4:188123535-188123557 ATGTATTTTTAGTAGACACAGGG + Intergenic
989306561 5:39964304-39964326 AGTTCCTTTTAGGTGACATAAGG + Intergenic
989547983 5:42696778-42696800 TGGTTTTTATACCTGACACATGG - Intronic
991466210 5:66915089-66915111 TTGTATTTTTAGGTGAGACAGGG - Intronic
992534800 5:77688980-77689002 TTGTATTTTTAGGAGACACAGGG + Intergenic
993133244 5:83925565-83925587 AGGTTTTTTTAGGTGGCTAGTGG + Intergenic
994563555 5:101410214-101410236 AGGTGTTTTTTGGTTAAACATGG - Intergenic
995629225 5:114115315-114115337 AGCATTTTATAGGTGACAAATGG - Intergenic
996551262 5:124732869-124732891 AGGTTCTTTTAGCTGAGAGAGGG - Intronic
996575534 5:124973207-124973229 GGGTTTTATTGGGTGAAACAGGG - Intergenic
997254199 5:132415216-132415238 AGGTTATTTCAGGTGGCGCAGGG + Intronic
997328936 5:133045183-133045205 ACGCTTTTTTATTTGACACAGGG - Intergenic
997551177 5:134754462-134754484 TGGTTTTTTTAGTAGAGACAGGG - Intergenic
997659383 5:135578098-135578120 AGGTTTTCTGAGTTGGCACAAGG + Intronic
998076129 5:139238004-139238026 TGGTATTTTTAGTAGACACAAGG + Intronic
998270541 5:140702461-140702483 TGGTTTTTTTAATTGAGACAGGG - Intronic
998398471 5:141834981-141835003 AGGTTTCTTTCTGTGCCACATGG - Intergenic
999187075 5:149719403-149719425 ATGTATTTTTAGTAGACACAGGG - Intergenic
1000541090 5:162541095-162541117 AACTTTTTAAAGGTGACACACGG - Intergenic
1001105469 5:168850083-168850105 AGGTTATTTTAACTGACAAAAGG + Intronic
1003342112 6:5231554-5231576 AGATTTTTTTAGTAGACACAGGG - Intronic
1003583640 6:7366071-7366093 TGGTATTTTTAGGAGAGACAGGG - Intronic
1004404865 6:15323575-15323597 AAGACTTTTTAGGGGACACAAGG + Intronic
1005654119 6:27914837-27914859 AGGTATTTTTAAGTGAAAAAAGG + Intergenic
1005898866 6:30200096-30200118 AAATTTTTTTAGTTGAGACAGGG - Intronic
1006788428 6:36683281-36683303 AGGTTTTACTAGGTGACCCTGGG - Intronic
1007049726 6:38814976-38814998 AGGTGGTTTTAGGTGAGTCACGG - Intronic
1008013154 6:46490624-46490646 AGTTATTTTTAGATGACCCAAGG + Intronic
1008616801 6:53234231-53234253 TGGTATTTTTAGTAGACACAGGG - Intergenic
1009423574 6:63489880-63489902 ATGTGTTTTTAGTAGACACAGGG + Intergenic
1009644242 6:66377422-66377444 ACGGTTTTTTAGCTGTCACATGG - Intergenic
1010600936 6:77825508-77825530 ACATTTTTTTAGGAAACACAAGG + Intronic
1011290175 6:85768751-85768773 AGGTTTTTTTTGTAGAGACAGGG - Intergenic
1011353250 6:86446328-86446350 AGGTTTTTTTAGGTGAAAATTGG + Intergenic
1012289461 6:97434866-97434888 AGCTCTTCTTTGGTGACACAGGG - Intergenic
1012291775 6:97464820-97464842 AGTTTTTTTTATGTGATATAGGG + Intergenic
1012307940 6:97682587-97682609 TTGTGTTTTTAGTTGACACAGGG + Intergenic
1012608262 6:101185101-101185123 AGGTTTTTTTGGGTGGCAGAGGG + Intergenic
1012662090 6:101912684-101912706 AGGTATTTTTTAATGACACAAGG - Intronic
1012789481 6:103675472-103675494 TGGTTTTTATATGTGACTCAAGG - Intergenic
1013119956 6:107132323-107132345 GGGTTTTTTTAGTAGAGACAGGG - Intergenic
1013513574 6:110865565-110865587 TGGATTTTTTAGCAGACACAGGG + Intronic
1013914028 6:115312610-115312632 AGGTTTTCTGATGTGCCACATGG + Intergenic
1014441838 6:121482609-121482631 TTGTTTTTTTAGTAGACACAGGG + Intergenic
1014850522 6:126334958-126334980 TTGTATTTTTATGTGACACAGGG - Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016001038 6:139041531-139041553 ATTTTTTTTTAGGAGAGACATGG + Intronic
1016913745 6:149225468-149225490 AGGTTTTTTGACATGACCCATGG + Intronic
1016946741 6:149541835-149541857 TGGTATTTTTAGTTGAGACAGGG - Intronic
1017893307 6:158657114-158657136 AGGGTTTTTAAGGTGGCAGATGG - Intronic
1019855706 7:3604772-3604794 TTGTATTTTTAGGTGAGACAGGG + Intronic
1021044078 7:15900862-15900884 AGGTTTTGTTATGTGACTCTGGG - Intergenic
1022217115 7:28274194-28274216 TGGTTTTTTTTGTTGAGACAGGG - Intergenic
1023979816 7:45062459-45062481 AAGGTTTTTTTGGTCACACATGG - Intronic
1025036440 7:55595420-55595442 AGGTCTTTTTACTTGCCACATGG + Intergenic
1025936328 7:66040760-66040782 ATGTATTTTTAGGAGAAACAGGG - Intergenic
1027211950 7:76156728-76156750 TTGTATTTTTAGTTGACACAGGG + Intergenic
1027212515 7:76162332-76162354 TTGTATTTTTAGGTGAGACAAGG - Intergenic
1027382050 7:77621494-77621516 TTGTATTTTTAGGAGACACAGGG - Intronic
1028601416 7:92604612-92604634 ATGTATTTTTAGTAGACACAGGG + Intergenic
1029458514 7:100682838-100682860 AGGCTTGTTTAGGTGGCAAAGGG + Intronic
1029573897 7:101390430-101390452 AGTTTTGTTTTGGTGAGACAGGG + Intronic
1031125258 7:117766264-117766286 GGGTTTTTTTGGTTGACAGAAGG - Intronic
1032207703 7:129882819-129882841 GCCTTTTTTTACGTGACACAAGG - Intronic
1033341793 7:140497905-140497927 TGGTATTTTTAGTAGACACAGGG + Intergenic
1035150610 7:156868499-156868521 TCGTATTTTTAGGAGACACAAGG - Intronic
1036992952 8:13619980-13620002 TGGTATTTTTAGTAGACACAGGG - Intergenic
1037614524 8:20506780-20506802 GGGTTTGTTTAGGTGGCACTAGG - Intergenic
1037696972 8:21231969-21231991 TTGTATTTTTAGGAGACACAGGG - Intergenic
1038490121 8:27964820-27964842 AGGAACTTTTAGGTGACAGATGG - Intronic
1038861460 8:31393104-31393126 TGGTTTTTTTAGTAGAGACAGGG - Intergenic
1038890530 8:31717232-31717254 TTGTTTTTTTAGTAGACACAGGG - Intronic
1040742870 8:50601524-50601546 ATGTTTTGTTAGCTGACATATGG + Intronic
1041561174 8:59219885-59219907 AAGTTATTTTAGGTCACTCAGGG + Intergenic
1042537231 8:69871032-69871054 TGGTATTTTTAGTTGAGACAGGG - Intergenic
1042562554 8:70083681-70083703 GGGTTTTTTTAGTAGACACGGGG + Intergenic
1042699266 8:71594406-71594428 AGGTTTGTTTGGGTGACTGAAGG + Intergenic
1043630896 8:82331924-82331946 ATTTTTTGTTAGGTAACACAGGG - Intergenic
1044556470 8:93567771-93567793 AGGTTTTTTTTGTAGAGACAAGG - Intergenic
1045550642 8:103169038-103169060 AGATTTTTTTAAAAGACACAGGG - Intronic
1047947786 8:129899711-129899733 AGGTTTTTAAAGGAGAAACAAGG + Intronic
1049139147 8:140935842-140935864 TTGTATTTTTAGGAGACACAGGG + Intronic
1051760466 9:20457983-20458005 GGGTTTTGGTAGGTGACAAAAGG - Intronic
1052553163 9:29978502-29978524 GGGTTTTTTTTAGTGACAAATGG + Intergenic
1053326129 9:37153341-37153363 TGGTATTTTTAGTAGACACAGGG + Intronic
1053530478 9:38876418-38876440 TTGTTTTTTCAGCTGACACATGG - Intergenic
1053798178 9:41745142-41745164 TTGTATTTTTAGTTGACACAGGG + Intergenic
1054147021 9:61569805-61569827 TTGTATTTTTAGTTGACACAGGG - Intergenic
1054186592 9:61957192-61957214 TTGTATTTTTAGTTGACACAGGG + Intergenic
1054202703 9:62100848-62100870 TTGTTTTTTCAGCTGACACATGG - Intergenic
1054466757 9:65500864-65500886 TTGTATTTTTAGTTGACACAGGG - Intergenic
1054635660 9:67487517-67487539 TTGTTTTTTCAGCTGACACATGG + Intergenic
1054651913 9:67631328-67631350 TTGTATTTTTAGTTGACACAGGG - Intergenic
1054765781 9:69041411-69041433 AGGTTCCTTTAGGTGACATTTGG + Intronic
1056343184 9:85659447-85659469 ATGTATTTTCAGATGACACATGG - Intronic
1057235947 9:93360373-93360395 TGGTTTTTTTAGTAGAGACAGGG + Intergenic
1057498110 9:95575919-95575941 AGGTTTTTTTAGGGGCCTCTGGG + Intergenic
1057940649 9:99280320-99280342 TGGTATTTTTAGTAGACACAGGG + Intergenic
1058282582 9:103134247-103134269 AGGTTTTTTTTTTTGAGACAGGG + Intergenic
1185556122 X:1022541-1022563 TTGTGTTTTTAGGAGACACAGGG + Intergenic
1186617117 X:11200900-11200922 AGATTTGTTTAGGTGACAGAAGG + Intronic
1188080626 X:25835739-25835761 AGCTTTTTTTTTTTGACACAGGG + Intergenic
1188628637 X:32321803-32321825 AGGCTTTTTCAGAAGACACAAGG + Intronic
1189162452 X:38823937-38823959 AGGTTTGTTTACTTCACACATGG + Intergenic
1189287439 X:39861474-39861496 TGGTTTTTCAAGGTGACCCAAGG - Intergenic
1189695907 X:43661785-43661807 AGGTCTTTCTACGTGACACTTGG - Intronic
1189911864 X:45818110-45818132 TGATTTTTTTAGGTGAGACAGGG - Intergenic
1191205438 X:57828384-57828406 TGTTTTTTTTAGTAGACACAAGG + Intergenic
1191247549 X:58239906-58239928 TTGTATTTTTAGTTGACACAGGG + Intergenic
1194785220 X:98075434-98075456 AGGATTTTTGAGGGGACAAAAGG + Intergenic
1195718122 X:107838476-107838498 CAGTTTTTTTAAGTGAGACAAGG - Intronic
1195836811 X:109124900-109124922 ACATTATTTTAGGTGATACATGG - Intergenic
1197213048 X:123843974-123843996 AGGGTTTAATAGGTGAAACAAGG + Intergenic
1197224455 X:123942687-123942709 TTGTATTTTTAGGTGAGACAGGG + Intergenic
1197404886 X:126037769-126037791 AGGTCTTTTTTGGTGAAAGATGG - Intergenic
1199281242 X:146002555-146002577 TTGTTTTTTTAGTAGACACAGGG - Intergenic