ID: 1119501497

View in Genome Browser
Species Human (GRCh38)
Location 14:75131805-75131827
Sequence ACTGGGACATTTTGTGCTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119501497_1119501502 2 Left 1119501497 14:75131805-75131827 CCAAAAGCACAAAATGTCCCAGT 0: 1
1: 1
2: 1
3: 23
4: 205
Right 1119501502 14:75131830-75131852 ATAGTTTCGGCATGAGTAAAGGG 0: 1
1: 1
2: 0
3: 5
4: 92
1119501497_1119501503 6 Left 1119501497 14:75131805-75131827 CCAAAAGCACAAAATGTCCCAGT 0: 1
1: 1
2: 1
3: 23
4: 205
Right 1119501503 14:75131834-75131856 TTTCGGCATGAGTAAAGGGAAGG 0: 1
1: 1
2: 2
3: 8
4: 136
1119501497_1119501504 7 Left 1119501497 14:75131805-75131827 CCAAAAGCACAAAATGTCCCAGT 0: 1
1: 1
2: 1
3: 23
4: 205
Right 1119501504 14:75131835-75131857 TTCGGCATGAGTAAAGGGAAGGG 0: 1
1: 1
2: 0
3: 12
4: 160
1119501497_1119501501 1 Left 1119501497 14:75131805-75131827 CCAAAAGCACAAAATGTCCCAGT 0: 1
1: 1
2: 1
3: 23
4: 205
Right 1119501501 14:75131829-75131851 GATAGTTTCGGCATGAGTAAAGG 0: 1
1: 1
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119501497 Original CRISPR ACTGGGACATTTTGTGCTTT TGG (reversed) Exonic
900167745 1:1250599-1250621 ACTGGGACAGCTTGTGCCCTCGG + Intergenic
903354820 1:22740237-22740259 ACTGGGATATATTGTTCTTTTGG + Intronic
907294911 1:53444485-53444507 ACTGGAACAGCTTGTGCCTTCGG - Intergenic
908582741 1:65533415-65533437 AATGGGAGAATTTGTGCTATCGG + Intronic
909432834 1:75609499-75609521 ACTGTGAAATCTTGTGCTGTTGG + Intronic
914758831 1:150582359-150582381 ACTGTGACATTTTGGGGATTAGG - Intergenic
918781554 1:188706126-188706148 ACTGAGACAGTTTATTCTTTAGG - Intergenic
920243021 1:204567632-204567654 ACTGGGGCAATTAGTGCTTGGGG - Intergenic
1064766916 10:18684574-18684596 ACTGGGGCATTCTGTGGGTTTGG - Intergenic
1066236761 10:33492451-33492473 ACTGCTACATTTTGGGCTTCGGG + Intergenic
1066984745 10:42454829-42454851 GCAGGGACATTTTGAGCTGTGGG - Intergenic
1068401456 10:56532951-56532973 ACTTGGAAATTTTGTTCTTGAGG + Intergenic
1071073618 10:81725749-81725771 TCTAGGAACTTTTGTGCTTTTGG - Intergenic
1072981184 10:100099028-100099050 ACTGGGACATTGGGGGATTTGGG + Intergenic
1073453059 10:103620684-103620706 GCTGGGACATTATGTTGTTTAGG + Intronic
1073928449 10:108544946-108544968 ACTGGAACAGCTTGTGCCTTCGG + Intergenic
1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG + Intronic
1077886543 11:6391571-6391593 ACTGGGACATTTTCTCATCTTGG + Exonic
1079442411 11:20528163-20528185 ACTGGGACATGCTTTTCTTTTGG - Intergenic
1081098492 11:38970219-38970241 ACTGGGCCCTTTTGAGCTTGGGG + Intergenic
1081463133 11:43289926-43289948 ACTGGCTCTTTTTGTTCTTTAGG + Intergenic
1087048771 11:93866297-93866319 AGTGGGACATTTTAGGCTCTGGG - Intergenic
1088056924 11:105594148-105594170 ACTGATACATTTTTTCCTTTGGG + Intergenic
1088510639 11:110570159-110570181 CCTGGGAGATTTTTTTCTTTGGG + Intergenic
1090535001 11:127631291-127631313 AATAGGTCATTTTGTGATTTAGG + Intergenic
1092739687 12:11615693-11615715 GCTTGTGCATTTTGTGCTTTGGG - Intergenic
1092876744 12:12855300-12855322 CCTGGGGTATTTTGTGTTTTTGG + Intergenic
1092934809 12:13350962-13350984 ACTGGGACTTGCTGAGCTTTGGG + Intergenic
1093612551 12:21180135-21180157 ATTTTGACATATTGTGCTTTAGG - Intronic
1094243176 12:28253110-28253132 AATTGGAAATTTTGTGCTTGTGG + Intronic
1094637829 12:32243916-32243938 ACTGGGACATTTAGCCATTTAGG - Intronic
1094656002 12:32419898-32419920 ACGTGCAGATTTTGTGCTTTTGG - Intronic
1095202525 12:39400871-39400893 AATTGGTCATTTTCTGCTTTAGG - Intronic
1096069501 12:48767133-48767155 CCTGGGACATGGTATGCTTTGGG - Exonic
1096521651 12:52187962-52187984 GCTGGGACATGGTGTGCGTTTGG + Intronic
1097582056 12:61470398-61470420 ACTGGGAATTTTTCTGCATTGGG - Intergenic
1098621441 12:72605182-72605204 ACTGATACTTTTTGTCCTTTGGG - Intronic
1099602118 12:84753807-84753829 ACTGGGGCCTGTTGTGCGTTGGG + Intergenic
1099861746 12:88231189-88231211 AGTGGGATATTTTAGGCTTTGGG + Intergenic
1099953384 12:89328561-89328583 ACTGGCACAGAGTGTGCTTTTGG - Intergenic
1100037550 12:90271500-90271522 ACTGGGACATTTTGCTTCTTAGG - Intergenic
1100741698 12:97600906-97600928 ACAGGGATATTTTCAGCTTTTGG - Intergenic
1106501589 13:30334520-30334542 ACTGGGTCATTTTGTCCTGTAGG + Intergenic
1108449557 13:50547568-50547590 ACTGGGACCTTTTGTGGGGTGGG + Intronic
1108610725 13:52081006-52081028 TCTGAGACATTTAGAGCTTTGGG + Intronic
1112062657 13:95756479-95756501 ACTTGTCCATTTTGTGTTTTAGG - Intronic
1112221828 13:97498770-97498792 AGTGGGCCATTTTGTTCTCTGGG + Intergenic
1112685624 13:101822357-101822379 AATAAGACAGTTTGTGCTTTTGG - Intronic
1113361178 13:109632944-109632966 ACAGGATCATTTAGTGCTTTAGG + Intergenic
1114895542 14:26985832-26985854 ACTGGCACAGGTTGTGCTTAGGG + Intergenic
1115066061 14:29261401-29261423 ACTGGGTCTTTTTCTGGTTTTGG + Intergenic
1116954593 14:50911150-50911172 ACTGGGACCTTTGGTTATTTGGG - Intronic
1119501497 14:75131805-75131827 ACTGGGACATTTTGTGCTTTTGG - Exonic
1121067044 14:90977654-90977676 AGTGGGCCAATTTCTGCTTTAGG - Intronic
1126777035 15:52109425-52109447 ACTGGGACTTTTTCTACTTTGGG + Exonic
1128467558 15:67925554-67925576 ACAGGGAGAGTTTGGGCTTTGGG + Intergenic
1129636179 15:77320814-77320836 ACTGGGGCCTGTTGTGCTGTGGG - Intronic
1129826907 15:78640491-78640513 CCTGGAATGTTTTGTGCTTTGGG - Intronic
1130564713 15:84983019-84983041 ACTGGGACATTTTGTGACTGGGG + Intronic
1131147806 15:90025729-90025751 ACTGGCACAATTTCTGTTTTGGG - Intronic
1131778826 15:95831892-95831914 ACTGGGACATTTTGGGACTCTGG + Intergenic
1135102577 16:19619316-19619338 ACTGGGACATCTTGTACTTCAGG + Intronic
1136671127 16:31859289-31859311 ACTGGAACAACTTGTGCCTTCGG - Intergenic
1136717216 16:32290256-32290278 ACTAGGAGCTTCTGTGCTTTGGG - Intergenic
1136747150 16:32600943-32600965 ACTTGGACATTTTATTTTTTTGG + Intergenic
1136835591 16:33496510-33496532 ACTAGGAGCTTCTGTGCTTTGGG - Intergenic
1139281505 16:65774551-65774573 AGTGGGCCATTTTGCCCTTTGGG - Intergenic
1139867634 16:70075684-70075706 AGAGGGACATTTTGTGATTTAGG + Intergenic
1140387699 16:74556181-74556203 AGAGGGACATTTTGTGATTTAGG - Intronic
1140574222 16:76146095-76146117 ATTTGGACATTTTGTTATTTGGG + Intergenic
1141488772 16:84357887-84357909 AGTGGGACATTTGGTGAATTTGG - Intergenic
1203009213 16_KI270728v1_random:227522-227544 ACTAGGAGCTTCTGTGCTTTGGG + Intergenic
1203049280 16_KI270728v1_random:860149-860171 ACTTGGACATTTTATTTTTTTGG + Intergenic
1203145769 16_KI270728v1_random:1796823-1796845 ACTAGGAGCTTCTGTGCTTTGGG - Intergenic
1144352482 17:14410919-14410941 TGTGGGACATCTTGTGCATTAGG + Intergenic
1147836314 17:43334625-43334647 ACTGGAACATCTTGTGCCTTCGG + Intergenic
1150388438 17:64777637-64777659 ACTCTGACATTTTGAACTTTAGG - Intergenic
1150673718 17:67225464-67225486 ACTGTCACATTTGGTGCTTTTGG - Intronic
1151306933 17:73268557-73268579 AATAGGACATTTTGGGCTTAGGG + Intergenic
1152157102 17:78641626-78641648 GCTGGGACATTTGGTCCTTGAGG + Intergenic
1152383281 17:79953313-79953335 ACTGGTTCAGTTTATGCTTTTGG + Intronic
1156041418 18:32827396-32827418 GCAGGAACATTTTGTGTTTTGGG + Intergenic
1156749059 18:40428316-40428338 ACTGTGACATGTTTTGCATTAGG + Intergenic
1157814189 18:50719230-50719252 TCTGGTGGATTTTGTGCTTTGGG + Intronic
1158757980 18:60349561-60349583 ACTTGGACATTTTTTTCTTTGGG + Intergenic
1158781171 18:60653748-60653770 ACATGGACATATTGTGCTTTGGG + Intergenic
1160034835 18:75290962-75290984 ACTGGGTGATTATGTACTTTGGG + Intergenic
1160062784 18:75548120-75548142 ACTGGGGCCTTTTGGGGTTTGGG + Intergenic
1162045957 19:8000660-8000682 ACTGGGTCAGGTGGTGCTTTGGG - Intronic
1162246573 19:9406635-9406657 ACTGGGTGAATTTGTTCTTTTGG - Intergenic
1163465591 19:17466682-17466704 ACTGGAACAGTTTGTGCCCTCGG + Intergenic
1163465633 19:17466898-17466920 ATTGGGAGATTTTGTATTTTAGG + Intergenic
1164973840 19:32556130-32556152 ACTGGGACACTTTGAGCATGAGG - Intergenic
925324508 2:3007497-3007519 CCTGGGGCGGTTTGTGCTTTAGG - Intergenic
926095404 2:10078356-10078378 ATTGTGACAGTTTGTGTTTTAGG - Intronic
928337869 2:30413594-30413616 ACTGGGACATTTTCAGCCTGTGG - Intergenic
929118062 2:38461316-38461338 ACAGGGACATTTTGCACTATTGG + Intergenic
929403205 2:41609947-41609969 ACTGGGCCATTTTCTCCTTCTGG + Intergenic
929412245 2:41710107-41710129 TAAGGGACTTTTTGTGCTTTAGG - Intergenic
930348041 2:50210972-50210994 ACTGTGTCATTTTGTTGTTTGGG - Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931966963 2:67545324-67545346 ACAAGTACATTTTGGGCTTTGGG - Intergenic
932810501 2:74821788-74821810 ACAGGGACATATTGTTCTTTTGG + Intergenic
935478625 2:103557374-103557396 ACTGAGAATTTTTGTGCTTGTGG - Intergenic
936484164 2:112912375-112912397 CCTGGGACATTTGGTGGCTTAGG + Intergenic
937446195 2:121960574-121960596 ATGGGGACATTGTGTGCTGTGGG + Intergenic
937824887 2:126357639-126357661 GCTGGGACATTTTCTGCCTTTGG + Intergenic
939282446 2:140081702-140081724 ACTGGAACATTTTGTGGTCTCGG + Intergenic
939529534 2:143340134-143340156 AGAGGGACATTTTGTCGTTTGGG + Intronic
941145547 2:161839720-161839742 ACTGGGACATTTTAAGCTCAGGG + Intronic
942240092 2:173954801-173954823 AGAGGGAAATTTTTTGCTTTAGG - Intronic
942860089 2:180598873-180598895 ACTGGGACATTATGTCCATTTGG + Intergenic
943073203 2:183166043-183166065 ACTGTAACATTTTGAGATTTAGG + Intergenic
943203340 2:184859617-184859639 AGTGGGAGATTTTGTTCTTTTGG + Intronic
944852731 2:203736400-203736422 ACAGGGACTTTATGTGGTTTAGG + Exonic
945314180 2:208352816-208352838 ACTGGAACCTTTTGTACCTTTGG + Intronic
945459549 2:210089567-210089589 ACTTAGACATTTTGTGACTTGGG - Intronic
1170787057 20:19476789-19476811 TCTGGAATTTTTTGTGCTTTGGG - Intronic
1172559058 20:35869729-35869751 ATTAGTACAGTTTGTGCTTTGGG - Intronic
1174797564 20:53534991-53535013 ACTGTGACATTTAGTGCTAACGG + Intergenic
1175622934 20:60466045-60466067 ATGAGGACATTTTGTTCTTTTGG - Intergenic
1177897580 21:26872641-26872663 ACTGGAACAGCTTGTGCCTTCGG + Intergenic
1178210079 21:30520240-30520262 ACTGTGAGTTTCTGTGCTTTTGG + Intergenic
1178456259 21:32754799-32754821 ACTGGGACATGTTGTGGGTAGGG - Intronic
1179953538 21:44725023-44725045 ACTGGCTCATTTGGAGCTTTTGG + Intergenic
1179953565 21:44725193-44725215 ACTGGCTCATTTGGAGCTTTTGG + Intergenic
1181424645 22:22826284-22826306 ACTCAGACATATTCTGCTTTTGG + Intronic
1181957968 22:26601994-26602016 ACAGGGAGATTTTGTGCTCCTGG + Exonic
949799927 3:7892577-7892599 TATGGGACAATATGTGCTTTTGG + Intergenic
952841766 3:37652497-37652519 GCTGGGACACTTTTTTCTTTTGG + Intronic
953029722 3:39170962-39170984 CCTGACACATTTTGTGTTTTTGG + Intergenic
955780738 3:62481798-62481820 ACTGGTAGATTTGGTACTTTGGG + Exonic
957423455 3:80003113-80003135 ACTGGGATATTTTATCCTGTAGG + Intergenic
958929595 3:100194984-100195006 ACTGGGACATTTTTGTGTTTTGG - Intergenic
959036914 3:101377363-101377385 ACTGGGACTGTTTCTGCTTGTGG - Intronic
962526262 3:136240426-136240448 AATGGGTGATTTTGAGCTTTTGG - Intergenic
965738766 3:171850585-171850607 CCTGGGGCTTTCTGTGCTTTGGG - Intronic
967178108 3:186879100-186879122 ACTGGGAAAGTTTGAGCATTGGG - Intergenic
967949651 3:194831017-194831039 ACTGGGAGATTCTGGCCTTTGGG - Intergenic
968779651 4:2570790-2570812 CCTGGGAGCTTTTGTGATTTAGG + Intronic
968856898 4:3132033-3132055 CCAGGCACAATTTGTGCTTTAGG - Intronic
969567785 4:7990002-7990024 TTTAGGACATATTGTGCTTTAGG + Intronic
969622526 4:8285862-8285884 ACTGCCACATTTGGGGCTTTAGG + Intronic
970550255 4:17173502-17173524 ACTGGGCCATTTTGTTCCTCTGG - Intergenic
971069008 4:23069222-23069244 ACTGGTTTATTTTGTCCTTTGGG - Intergenic
971443875 4:26721204-26721226 GCTGGGACATATTAAGCTTTAGG - Intronic
972207492 4:36794289-36794311 ACAGAGACATTTTGTGTTTGTGG - Intergenic
972708796 4:41572963-41572985 AATGGGACAGTTTCTGCATTAGG + Intronic
973017917 4:45164995-45165017 ACTGGCAGTTTTTCTGCTTTTGG + Intergenic
973959901 4:56099493-56099515 ACTGGGGCATTTTAGGCTTTTGG + Intergenic
974373848 4:61050943-61050965 GCTGAGACATCTTGTGCATTTGG + Intergenic
976100089 4:81552319-81552341 ACTGGAACATTTTGGTCTTGTGG + Intronic
979759855 4:124388873-124388895 TCTGGGACTTTTTGTGTTTAGGG + Intergenic
980863019 4:138521850-138521872 CCTGGGAGCTTTTGTGCATTGGG + Intergenic
981066565 4:140492298-140492320 ACTGGGACATTTGGAGCTGAAGG - Intronic
981821876 4:148896678-148896700 ACAGGCACATTTTGTTTTTTTGG + Intergenic
982160985 4:152569267-152569289 ACAGTTACATTTTGTGCTTCGGG - Intergenic
982882856 4:160742067-160742089 GCTTGGACATTTTGTGTCTTAGG - Intergenic
983139369 4:164129775-164129797 ACTGGGACCTATTGTGGTTGGGG + Intronic
983528292 4:168783376-168783398 ACTGGGACAGTTTGGTCTTCAGG + Intronic
983756052 4:171337709-171337731 ACTGGGACCTTTTGTGGGGTGGG + Intergenic
986118573 5:4805991-4806013 ACTGGGACCTTTTGGGGGTTGGG + Intergenic
988108736 5:26786219-26786241 ACTTAGGTATTTTGTGCTTTAGG + Intergenic
988257342 5:28837581-28837603 ACTGGGGCATCTTAGGCTTTTGG - Intergenic
988965300 5:36410702-36410724 ACTGGGGCATGTTGTGGGTTGGG - Intergenic
992665819 5:79008212-79008234 ACTGGGTCATTTTCTTCCTTGGG - Intronic
993576038 5:89602035-89602057 CCTGGGAATTTTTGTGTTTTTGG + Intergenic
994354393 5:98778659-98778681 ATTGGTAGTTTTTGTGCTTTAGG + Intronic
998443819 5:142183430-142183452 ACTGGGTCACTTTGTCCATTTGG + Intergenic
1004928018 6:20434539-20434561 ACTGATACATTTAGAGCTTTCGG - Intronic
1006255380 6:32828710-32828732 ATTTGGACACTGTGTGCTTTTGG - Intronic
1006529505 6:34639157-34639179 TGTGGGACATATTGTGGTTTGGG + Intronic
1006729236 6:36223398-36223420 ATTGGCACACTTTGTGCTTCTGG + Intronic
1009984034 6:70761072-70761094 ACTGGAAGATTTTCTTCTTTGGG + Intronic
1011470165 6:87701173-87701195 ACAGGGACATCTTTTTCTTTGGG - Intronic
1014764777 6:125393730-125393752 AGTGGGGTATTTTGTGGTTTTGG + Intergenic
1015156006 6:130096956-130096978 ACTAGCAGATTTTGTGCCTTGGG + Intronic
1015292678 6:131556112-131556134 TCAGGGAAAGTTTGTGCTTTGGG - Intergenic
1015591822 6:134829685-134829707 ACTGGGACATTCAGGGCATTGGG + Intergenic
1017760758 6:157566396-157566418 CCTTGGCCATTTTGTGCTCTGGG - Intronic
1020809941 7:12839619-12839641 ACTGGGACTTTTTGGACTGTGGG + Intergenic
1021954116 7:25806792-25806814 GCTGGGACATTCAGTGGTTTAGG + Intergenic
1022204139 7:28147219-28147241 ATTGGGACATTTTGGATTTTGGG - Intronic
1022425182 7:30261810-30261832 ACCTGAACGTTTTGTGCTTTGGG + Intergenic
1028609608 7:92695697-92695719 ACAGAGAAGTTTTGTGCTTTGGG + Intronic
1030137654 7:106271995-106272017 AAGGGTACATTTTGGGCTTTGGG - Intronic
1030789273 7:113704198-113704220 ACCGGGACCTTTTGTGGGTTTGG - Intergenic
1032264588 7:130362194-130362216 CCTGGGAAATTCTGTGCTTCTGG + Intronic
1032497578 7:132374277-132374299 ACTGGGAGATTGTGTTCATTAGG + Intronic
1032890913 7:136193541-136193563 ACTTTGACTTTTTGGGCTTTTGG + Intergenic
1033061565 7:138113987-138114009 TCTGTGACATTTTGTGACTTCGG + Intronic
1033903483 7:146172364-146172386 GCTGGAAAATTCTGTGCTTTGGG - Intronic
1034286763 7:149889278-149889300 ACTTTGACATTTTGCTCTTTGGG - Intergenic
1034484553 7:151350712-151350734 ACTGGAACAATTTGTGCCCTCGG + Intronic
1035365074 7:158344091-158344113 AGGGGGACATTTTGTGTTTTTGG - Intronic
1037554804 8:20011910-20011932 ACTGGGAACTTTTGTGCTTTGGG - Intergenic
1039603174 8:38858872-38858894 GCTGGGCCTATTTGTGCTTTTGG + Intergenic
1040448717 8:47522617-47522639 ACAGTGACATTGTGTGATTTTGG - Intronic
1042061438 8:64822543-64822565 ACTGTGAAATTTTAGGCTTTGGG - Intergenic
1043916565 8:85929437-85929459 ACTGGGAAATCTTGTGGCTTAGG - Intergenic
1044428247 8:92079522-92079544 ACTGAGACACTGTGTGATTTGGG + Intronic
1045567964 8:103340443-103340465 ATTGGAACATTTTGTCCTCTTGG - Intergenic
1045786059 8:105921914-105921936 CTTGGGACATTGTGTGTTTTTGG - Intergenic
1046776167 8:118166109-118166131 ACTGGCACATTTTTTTCTTGTGG + Intergenic
1048343273 8:133556818-133556840 GGGGGGACATTTTGTTCTTTTGG + Intronic
1048434122 8:134400019-134400041 ACAGGGAACTTTTGTGATTTTGG - Intergenic
1048589030 8:135803825-135803847 ACTGGGACCTGTTGTGCAGTGGG - Intergenic
1049873263 8:144998541-144998563 ACTAGGACATTTTGTGCTTTTGG + Intergenic
1050227294 9:3474695-3474717 ACTGCAATATTTTGTGGTTTGGG - Intronic
1051355615 9:16237404-16237426 TCGGGGCCATTTTGTGATTTGGG - Intronic
1052277633 9:26695277-26695299 ACTGTGACATTTTCTGCTCTGGG + Intergenic
1055189602 9:73501395-73501417 ACTGGAACATATTTTGGTTTAGG - Intergenic
1057834507 9:98433603-98433625 ACTGGGACATCATGTCCTCTAGG + Intronic
1060107007 9:120878783-120878805 ATTGGGAGATTTTGTGCCATGGG - Intronic
1060362270 9:122970716-122970738 ACTGGGACTTTTGGAGTTTTGGG - Intronic
1185461530 X:334898-334920 ACTGGGAGCTTCTGTGCTTTGGG - Intronic
1188019199 X:25138457-25138479 ATTGTGCCATTCTGTGCTTTTGG + Intergenic
1189949832 X:46217276-46217298 TTTGGGACATTTTGTTGTTTTGG + Intergenic
1190047645 X:47125516-47125538 ACTGGGACAGGGTTTGCTTTGGG - Intergenic
1190486813 X:50935010-50935032 ACAGGACCATTTTGTGCTCTGGG - Intergenic
1192166955 X:68832466-68832488 ACTGGGAGATTTTCTTTTTTGGG - Intronic
1193082910 X:77423245-77423267 ACAGGGAGTTTTTGAGCTTTAGG - Intergenic
1193222439 X:78942375-78942397 ACTAGGACATTTTATTCTCTGGG + Intergenic
1195633170 X:107081636-107081658 ACAGAGACATTTTGTGTTCTTGG - Intronic
1199717100 X:150514725-150514747 ATTGGAACATTTTGTACCTTAGG - Intergenic
1199950549 X:152702578-152702600 GCTGGGGCATTTTGGGCTTTGGG + Intergenic
1199955406 X:152737913-152737935 GCTGGGGCATTTTGGACTTTGGG + Intergenic
1199959133 X:152765883-152765905 GCTGGGGCATTTTGGGCTTTGGG - Intergenic
1200018710 X:153184111-153184133 GCTGGGGCATTTTGGGCTTTGGG + Intergenic
1200403371 Y:2782846-2782868 ACTGGGCTATTTTGAGCTTGAGG - Intergenic
1201541026 Y:15104846-15104868 ACTGGTAGAATTTGTGCTTCTGG + Intergenic