ID: 1119514948

View in Genome Browser
Species Human (GRCh38)
Location 14:75240679-75240701
Sequence GGCTGATCACCATGGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119514948_1119514953 3 Left 1119514948 14:75240679-75240701 CCATCTCACCATGGTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1119514953 14:75240705-75240727 ATGGATCAGCATCTTTCCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 138
1119514948_1119514956 24 Left 1119514948 14:75240679-75240701 CCATCTCACCATGGTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1119514956 14:75240726-75240748 GGTTTTCCCACCATCTATGGCGG 0: 1
1: 0
2: 0
3: 9
4: 70
1119514948_1119514957 25 Left 1119514948 14:75240679-75240701 CCATCTCACCATGGTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1119514957 14:75240727-75240749 GTTTTCCCACCATCTATGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 111
1119514948_1119514955 21 Left 1119514948 14:75240679-75240701 CCATCTCACCATGGTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1119514955 14:75240723-75240745 AGCGGTTTTCCCACCATCTATGG 0: 1
1: 0
2: 0
3: 4
4: 64
1119514948_1119514958 26 Left 1119514948 14:75240679-75240701 CCATCTCACCATGGTGATCAGCC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1119514958 14:75240728-75240750 TTTTCCCACCATCTATGGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119514948 Original CRISPR GGCTGATCACCATGGTGAGA TGG (reversed) Intronic
900118422 1:1038449-1038471 GGCAGCTCACCAGGGTGAGCGGG - Intronic
900351657 1:2237955-2237977 GGCTGATCACCCTCGTGTGGCGG + Intronic
900405098 1:2489523-2489545 GAGTGACCACCATGGGGAGATGG - Intronic
903719033 1:25390740-25390762 GGAAGATCAGCATGGTGAGCAGG - Exonic
906154026 1:43603618-43603640 TGCTGATCATCATGGTGGGCCGG - Exonic
907414388 1:54304262-54304284 GGCTGTTTACCATGCTGAAAAGG + Intronic
909703366 1:78552576-78552598 GGCTGCTAATCCTGGTGAGAGGG - Intergenic
910675232 1:89809550-89809572 GACTGAACACCATGGTTAGCTGG + Intronic
911190400 1:94942877-94942899 GACTGATCAGCTCGGTGAGAGGG - Intergenic
915857533 1:159405623-159405645 GGCTGATGACCACTATGAGATGG + Intergenic
922442645 1:225669130-225669152 TGCTGATACCCATGGTGACATGG - Intergenic
923868351 1:237963985-237964007 GGCAGATCAGCAGTGTGAGAAGG + Intergenic
1072965810 10:99971718-99971740 GCCTGGCCAACATGGTGAGATGG - Intronic
1074134044 10:110611660-110611682 GGTTCATCCCCATGGTGAGCAGG + Intergenic
1074904925 10:117853123-117853145 GGTTGAGCCCCATGGAGAGATGG + Intergenic
1075548885 10:123377525-123377547 GGCTCAGCACCATGGAGGGATGG + Intergenic
1075738605 10:124679522-124679544 GGCAGAGCCCCATGGAGAGAGGG + Intronic
1076026148 10:127115201-127115223 AGCTGATCCCCATGCTGATAAGG + Intronic
1077395130 11:2316807-2316829 GGCTGAGCACCAGGGTGGGGTGG + Intronic
1078925962 11:15875283-15875305 GCCTGACCAACATGGTGAAACGG - Intergenic
1079158127 11:17967832-17967854 GGCTGACCAGCATTGTGAGCTGG - Intronic
1080839481 11:35970983-35971005 GGCTGAGCACCAGGGAGAGATGG - Intronic
1083588891 11:63880773-63880795 GAGTGATCACCAAGGTGAGCTGG - Intronic
1084372916 11:68756460-68756482 GGCTGGTCACCAAGGTGAGCCGG + Exonic
1085658595 11:78340891-78340913 GGCTGATCACCATTGTGATGAGG - Intronic
1085722918 11:78929073-78929095 GGCAGCTCACCATGCAGAGAAGG + Intronic
1089195559 11:116692343-116692365 GACTGAGCACCATGGTGTGGAGG - Intergenic
1091455622 12:605234-605256 GGCTGTGCATCATGGGGAGAGGG + Intronic
1092922416 12:13244544-13244566 GGCTGATCATCCTGGGGAAAGGG + Intergenic
1096606633 12:52771168-52771190 GGCTGAGCAGCGTGGAGAGATGG - Exonic
1096609457 12:52791375-52791397 GGCCGAGCAGCATGGAGAGATGG - Exonic
1098140006 12:67441673-67441695 GCTAGATCACCATGGAGAGAAGG + Intergenic
1101589817 12:106115766-106115788 GGCTCATCCCCATGATGGGACGG - Intronic
1104570180 12:129918175-129918197 TGCTGATCTCCATGTGGAGATGG + Intergenic
1105304937 13:19161637-19161659 GCCTGACCACCATGGTGACCTGG - Intergenic
1109277444 13:60318301-60318323 GGAGAATCACCATGGAGAGAAGG + Intergenic
1112176759 13:97033440-97033462 GGCTGATGGCCATGTTGGGATGG - Intergenic
1119401984 14:74369021-74369043 GGCCGGTCAGCAGGGTGAGAGGG + Intergenic
1119514948 14:75240679-75240701 GGCTGATCACCATGGTGAGATGG - Intronic
1119713275 14:76838791-76838813 GCCTGGACAACATGGTGAGATGG - Intronic
1120601423 14:86514841-86514863 GCCTCAACACCATGGTCAGAAGG - Intergenic
1120929750 14:89836525-89836547 GGCTCTTCACCATGGGGAGCAGG + Intronic
1122794126 14:104197194-104197216 GGTTGATCCCAGTGGTGAGATGG + Intergenic
1124355433 15:28991720-28991742 TGCTGAGCACCATGGTCAGCAGG - Intronic
1124579281 15:30938549-30938571 TGCTCATCACCATTGTGGGAGGG + Intronic
1125530791 15:40412227-40412249 GGCAGAACACAATGGTGAGCTGG + Intronic
1128709807 15:69863339-69863361 AGCTGATAAAAATGGTGAGATGG + Intergenic
1131046946 15:89322450-89322472 GGCTGAGGACCATGGAGAGCTGG - Intronic
1132210367 15:100017429-100017451 GGCTGAACACCACAGGGAGAAGG - Intronic
1135406515 16:22201977-22201999 GCTCTATCACCATGGTGAGATGG + Intergenic
1136287336 16:29252315-29252337 GGCTCAGCCCCATGGTGGGATGG + Intergenic
1138286319 16:55812894-55812916 GGTTGATTCCAATGGTGAGAAGG - Exonic
1139198766 16:64950935-64950957 CGCTGATCACTATGGGCAGAAGG + Exonic
1139357129 16:66373041-66373063 GCCTGATCACAGTGGTGAGCAGG - Intronic
1140228747 16:73099990-73100012 GGCTGATACCCATAGTGAGATGG - Intergenic
1141036680 16:80632783-80632805 GGATGAAGACCATGGGGAGAGGG - Intronic
1142092949 16:88224944-88224966 GGCTCAGCCCCATGGTGGGATGG + Intergenic
1142570220 17:868799-868821 GGGTGATCACGATGTAGAGAAGG - Intronic
1144034405 17:11352686-11352708 GGCTGAGCATGATGGAGAGAGGG + Intronic
1144074457 17:11704328-11704350 GGCCAATCAGCATGGTGATAAGG - Exonic
1144637766 17:16921196-16921218 GGCTGTGGACCATGGGGAGAGGG - Intergenic
1144970624 17:19107000-19107022 GGCTGACCAACATGGTGAAACGG + Intergenic
1144990927 17:19233162-19233184 GGCTGACCAACATGGTGAAACGG + Intronic
1146499029 17:33348573-33348595 GGCACAACACCAGGGTGAGAGGG + Intronic
1146564427 17:33900043-33900065 GTGTGATCACCATGGAGAAAGGG - Intronic
1147163455 17:38580728-38580750 GGATGGTGACCATGGTGAGAGGG - Intronic
1148143114 17:45342323-45342345 GGCTGAGCAGCTTGCTGAGATGG - Intergenic
1148339134 17:46863037-46863059 GGCTGAGGACCATGGCGGGATGG + Intronic
1148971966 17:51491476-51491498 GGCAGATCCACATGGTGAAATGG - Intergenic
1150587006 17:66528003-66528025 GCCTGGCCAACATGGTGAGATGG + Intronic
1152541757 17:80980122-80980144 GGCTGCTCCCCCTGGGGAGAAGG - Intergenic
1154243018 18:12669438-12669460 GCCTGGTCAACATAGTGAGATGG - Intronic
1161616685 19:5274740-5274762 GGCTGGTCACCATGGAGGGGGGG - Intronic
1163635334 19:18434706-18434728 GGGTGATGACCATGGGCAGAGGG + Exonic
1163875826 19:19866688-19866710 GCCTGACCAACATGGTGAAACGG - Intronic
1167661493 19:50798377-50798399 GGCTGCTCTCCATGGTGCCAGGG - Exonic
1168557269 19:57353533-57353555 GGCTGGACACAGTGGTGAGAGGG + Intronic
929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG + Intronic
931014928 2:57965804-57965826 GGCTGGTCACAATGCTGACAGGG - Intronic
931753016 2:65347305-65347327 GGCTGCTGAACATAGTGAGAGGG + Intronic
932373869 2:71217333-71217355 GCCTGACCAACATGGTGAAATGG - Intronic
934653583 2:96105775-96105797 GGCTGCCCACCCTGGTGTGAGGG - Intergenic
935961326 2:108428502-108428524 GGCTAACCACCATGGAGACATGG + Intergenic
947071623 2:226293813-226293835 GGTTTGGCACCATGGTGAGAAGG - Intergenic
947751454 2:232534924-232534946 GGCTGATCACTCTGTTGAGGAGG - Intronic
948162191 2:235834145-235834167 GCGTGATCACCGTGGTCAGATGG + Intronic
1175674317 20:60933834-60933856 GGGTGATGACCAGTGTGAGATGG - Intergenic
1175824523 20:61929851-61929873 GGCTGAGCACCAGGGTGGGCAGG + Intronic
1176216469 20:63950380-63950402 GCCTGGGCAACATGGTGAGACGG + Intronic
1177221272 21:18195959-18195981 TGATGTTCACCATGGTCAGAAGG - Intronic
1178823812 21:35998594-35998616 GACCAATCACCATGGTGGGAAGG + Intronic
1179264778 21:39793749-39793771 AGCTGGTCAGCATGGAGAGATGG + Intronic
1182664457 22:31946924-31946946 GGTTTATCACCATTCTGAGATGG - Intronic
1183426131 22:37740409-37740431 GGCAGGTAACAATGGTGAGAAGG + Intronic
953706046 3:45231147-45231169 TCCTGACCACCATGGTCAGAAGG + Intergenic
953851636 3:46469585-46469607 TGCTGATCACCCTGAAGAGAGGG + Intronic
956750065 3:72338008-72338030 GGCTGACGGCCATGGAGAGAGGG - Intergenic
956777882 3:72580693-72580715 GGCTGATCTCCATGGGCAGCTGG - Intergenic
959971309 3:112413454-112413476 GGCTGGGCACCATGGTCAGTTGG + Intergenic
960237316 3:115298808-115298830 GACTGATTAATATGGTGAGATGG - Intergenic
960855052 3:122094104-122094126 GGCTGGTCACTTTGATGAGAAGG - Intronic
962580235 3:136791417-136791439 GGCTGAGCACCAAAGAGAGATGG + Intergenic
962611275 3:137078591-137078613 GGCTTATCAATATGGTGAGTAGG - Intergenic
962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG + Intronic
965733026 3:171792481-171792503 AGCTGATCTGCAAGGTGAGAAGG + Intronic
967543944 3:190701565-190701587 GGCTGATCTCCATGAAAAGATGG + Intergenic
967964607 3:194951196-194951218 GGCTGAGCACCTGGGTGGGACGG - Intergenic
973168350 4:47106947-47106969 ACCCAATCACCATGGTGAGATGG - Intronic
977918177 4:102616279-102616301 GACTGCTCACCGTGGTGGGAAGG - Intronic
979568064 4:122179457-122179479 GGCTGATCTCCATGCTTACATGG + Intronic
982883008 4:160743632-160743654 GGCTGAAGATCATGATGAGATGG - Intergenic
983564618 4:169136404-169136426 GGCTGATCTCCATGGAGTGGCGG + Exonic
984645796 4:182218464-182218486 GCCTGATGACCCTGGTGAGTAGG + Intronic
985140156 4:186831637-186831659 GGGTGATGTCCATGGTGAGCTGG + Intergenic
985670153 5:1202750-1202772 AGCAGCTCTCCATGGTGAGAAGG - Intronic
986724621 5:10585033-10585055 AGCAGAGCACCATGGGGAGAGGG + Intronic
986866839 5:11999365-11999387 AGCTGATCACCATGTTGAGCAGG + Intergenic
987100650 5:14588653-14588675 GGATGATCTCCATGGTGTCAGGG + Intronic
989151993 5:38308752-38308774 GTCTGACTACCTTGGTGAGATGG - Intronic
990330693 5:54722638-54722660 GGCAGAGCAGCATGCTGAGAAGG + Intergenic
996779491 5:127170659-127170681 GGGTGATCAGCCTGGTGAGGGGG - Intergenic
996895559 5:128477789-128477811 CACTGATCATCATGGTGCGAGGG + Intronic
1000197300 5:158972128-158972150 GGCTGATGACCTTTGTGGGAAGG + Intronic
1006326297 6:33356483-33356505 GGCAGGTGACCATGGTGAGGAGG - Intergenic
1006436845 6:34030109-34030131 GGCTGGTGGCCAGGGTGAGAAGG + Intronic
1006748602 6:36362668-36362690 GCCTGATCTCCCTGGGGAGATGG + Intronic
1013980915 6:116128026-116128048 TGCTGTTCTCCATGGTCAGATGG + Intronic
1017575580 6:155798720-155798742 GGGTGATAACCATGCTGAGCTGG + Intergenic
1017969751 6:159301805-159301827 GCCTGACCAACATGGTGAAACGG - Intergenic
1024306355 7:47932616-47932638 GGCTCATCAGCAGGGTGAGGTGG - Intronic
1026006185 7:66602053-66602075 GCCTGTGCACCCTGGTGAGAAGG + Intergenic
1028483268 7:91331402-91331424 TGATGATAACGATGGTGAGATGG + Intergenic
1029446383 7:100615153-100615175 GGAGGAACACCATGGTGAGGAGG - Exonic
1029506297 7:100965874-100965896 GGCTGATGCCGATGGTGAGCGGG - Intronic
1030223982 7:107128390-107128412 AGCTGATCACCCTGGGGTGATGG + Intronic
1032360439 7:131250146-131250168 GGCTGATCGCCATGGTCAGTTGG - Intronic
1034086722 7:148328773-148328795 GCCTGACCAACATGGTGAAATGG + Intronic
1036551843 8:9822969-9822991 GCCTGGTCAACATAGTGAGATGG - Intergenic
1036756622 8:11475426-11475448 AGCTGAACATCAGGGTGAGAAGG - Intergenic
1038185867 8:25274249-25274271 GGCTGATCATAAAGGTGGGAGGG - Intronic
1044355469 8:91217548-91217570 GACTAATCACCATTGTCAGAGGG + Intronic
1044969064 8:97602225-97602247 GCCTGAGCAACATGGTGAAACGG + Intergenic
1045626231 8:104054635-104054657 GGCTGATCACCATGGATATAAGG + Intronic
1049068314 8:140337220-140337242 CTCTGATCATCATGGTTAGAGGG - Intronic
1049588552 8:143443078-143443100 GCCTGACCAACATGGTGAAACGG + Intronic
1055319188 9:75065509-75065531 GCCTGAGCAACATAGTGAGAGGG - Intronic
1056690774 9:88807032-88807054 TGCTGAGCACCATTTTGAGATGG + Intergenic
1056956947 9:91090252-91090274 TGCTGACCTCCATGGGGAGACGG - Intergenic
1057988197 9:99739568-99739590 GCCTGGGCAACATGGTGAGATGG + Intergenic
1060944204 9:127560370-127560392 AGGTGAACCCCATGGTGAGAGGG - Intronic
1061330201 9:129887614-129887636 GGCTTATCTCCACGGTGAGCAGG + Exonic
1061763624 9:132867907-132867929 AGCTGACCAGCATGGTGAGAAGG + Intronic
1186960458 X:14730969-14730991 GGCTAGTCACTATGGTCAGATGG - Exonic
1189646475 X:43138260-43138282 TGCTAATCCCCATGGTGTGAGGG + Intergenic
1194626438 X:96231633-96231655 GACTGATAACCATTGTGAGTGGG - Intergenic
1195923693 X:110004787-110004809 TGGTGATCACTATGGTGAGAGGG + Intronic
1198061311 X:133047760-133047782 GTGTCATCACCATGGTGAAAAGG - Intronic
1198672536 X:139096380-139096402 GGGTGGTCAAAATGGTGAGAAGG + Intronic
1198673565 X:139107759-139107781 TGATGATCACAATGATGAGAAGG + Intronic
1199898992 X:152154426-152154448 GGCTCAATACCATGGAGAGAGGG - Intergenic
1200780723 Y:7213094-7213116 TGAAGATCACCATGGTGACAAGG + Intergenic