ID: 1119517353

View in Genome Browser
Species Human (GRCh38)
Location 14:75258766-75258788
Sequence TATGGCCAACTGACGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119517353 Original CRISPR TATGGCCAACTGACGGTGGA GGG Intronic
903860972 1:26364393-26364415 TAGGGCCAAGTGACCTTGGATGG - Intronic
910081752 1:83350303-83350325 TGGGGCCTACTGAGGGTGGAAGG - Intergenic
917661789 1:177184011-177184033 TATGGGGAACTGAAAGTGGAAGG - Intronic
1066662123 10:37747040-37747062 TATGGCAAACTGAAGTTGAATGG - Intergenic
1080480488 11:32644322-32644344 CAGGGCCTACTGAGGGTGGAGGG + Intronic
1081253696 11:40866968-40866990 TTTGGCCAAGTGAAGATGGAGGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1093914689 12:24788460-24788482 AATAGCCACATGACGGTGGAAGG + Intergenic
1097381207 12:58897853-58897875 TATGTGAAAATGACGGTGGAAGG - Intronic
1101241883 12:102847141-102847163 AAGGGCCAAGTGAGGGTGGAAGG - Intronic
1102531663 12:113551194-113551216 TTTGGCCAACAGAATGTGGAGGG - Intergenic
1104547018 12:129721854-129721876 TATGGCCAACTGGCTGGTGATGG - Intronic
1113409379 13:110071293-110071315 TACTACCAACTGACGATGGACGG - Intergenic
1117847715 14:59929912-59929934 TGGGGCCTACTGAAGGTGGAGGG + Intronic
1119517353 14:75258766-75258788 TATGGCCAACTGACGGTGGAGGG + Intronic
1122461760 14:101901843-101901865 TTTGGCCAACTGCCGGAAGAGGG - Exonic
1141017155 16:80461363-80461385 TATGGCCAAGTGGTGGTGGCTGG - Intergenic
1146916066 17:36679292-36679314 TGTGGCCACCTGCCAGTGGAAGG - Intergenic
1147473331 17:40685178-40685200 TATTGCCAAATGAGAGTGGAAGG - Intergenic
1147587939 17:41663472-41663494 TATGGCCAAAAGATGATGGAGGG + Intergenic
1147742968 17:42679194-42679216 TGAGGCCAGGTGACGGTGGAGGG + Exonic
1149654726 17:58304287-58304309 TATGGTCAAGTGGGGGTGGACGG + Intronic
1153242721 18:3045214-3045236 CAAGGCCAGCTGAGGGTGGAAGG + Intergenic
1155984451 18:32215240-32215262 TATATCCTACTGACAGTGGAAGG + Exonic
1157382563 18:47232627-47232649 CATGGCCCACTGACTGAGGAAGG - Intronic
1159202612 18:65206729-65206751 TGTGGCCCTCTGCCGGTGGAGGG + Intergenic
1162723767 19:12677456-12677478 TATGACTATCTGACTGTGGATGG + Intronic
927268667 2:21182202-21182224 TGTGGCCAGCTGACTGAGGAAGG - Intergenic
931553353 2:63471414-63471436 TATGGCCAACTGCAGCTGGAAGG + Intronic
947517594 2:230821160-230821182 TATCACCAACTGAAAGTGGAGGG + Intergenic
948087757 2:235265646-235265668 AGTGGCCATCTGACAGTGGATGG - Intergenic
1175182877 20:57160876-57160898 TAGGACCAACTGAAGGCGGAAGG - Intergenic
1183035161 22:35135576-35135598 TTTGGCAAACTGAGGGTGAAGGG + Intergenic
949917948 3:8979427-8979449 TAGGGCCATCTCATGGTGGAAGG - Intergenic
954170190 3:48795468-48795490 TATATCCCACTGAGGGTGGATGG - Intronic
954686687 3:52374536-52374558 TTTGGCCAACTGCCGGAAGAGGG - Intronic
959441216 3:106377790-106377812 TATGGCAAATTGACTGTGGGTGG + Intergenic
961003266 3:123388309-123388331 TATGACCAACTGAAAGTGGGAGG + Intronic
971026658 4:22595322-22595344 AATGAACAACTGAAGGTGGAAGG - Intergenic
972417474 4:38856083-38856105 TTTGTCAAACTGAAGGTGGAAGG + Intronic
975978884 4:80132588-80132610 TATGTCCATCTGAAGGTGAATGG + Intergenic
985244172 4:187962868-187962890 TATGGGCAACTGACTGTAGCCGG + Intergenic
989286077 5:39701621-39701643 TATGGCCATATGAGGGTGGCTGG + Intergenic
993664104 5:90673639-90673661 TATGCCCTCCTCACGGTGGAAGG + Intronic
994109814 5:95988650-95988672 TATAGCTAACTGATGTTGGATGG + Intergenic
1001206461 5:169768147-169768169 TCTGGCCAACGGACCGTGGGTGG - Intronic
1003114574 6:3275173-3275195 TATGGTCAACTGACTGTAGATGG + Intronic
1003397827 6:5768429-5768451 TATTGCCAATTGAAGATGGATGG - Intronic
1003990169 6:11478740-11478762 TGGGGCCTACTGAGGGTGGAGGG + Intergenic
1006045435 6:31291793-31291815 TAAGGACAACTGACTGTAGAAGG + Intronic
1006955842 6:37870634-37870656 TAAGGCCAAAAGACAGTGGAAGG - Intronic
1019773185 7:2896494-2896516 CATGGCCAGCTCACGGTGGGGGG - Intergenic
1024295641 7:47839752-47839774 GATGGCCCACAGAGGGTGGATGG + Intronic
1024607822 7:51037223-51037245 TATGTACAACTGACTGAGGAAGG - Intronic
1027299238 7:76812588-76812610 TGGGGCCTACTGAGGGTGGAAGG - Intergenic
1030327434 7:108235673-108235695 TATGGCCAAATGTCCCTGGAAGG - Intronic
1030428577 7:109412404-109412426 TTTGGCCAACTTACAATGGAAGG + Intergenic
1030895432 7:115053843-115053865 AATAGCCCACTGACAGTGGATGG + Intergenic
1033468205 7:141617011-141617033 TATGGCCAACTGACTTTGGGAGG - Intronic
1034522794 7:151632952-151632974 TATGGCCAACTCAGGTTGGCAGG + Intronic
1045391727 8:101721806-101721828 TATGGCCAACTGCTGTAGGAAGG + Intronic
1047899278 8:129402347-129402369 TATGGCCAAATGTCCCTGGAGGG - Intergenic
1049173872 8:141179562-141179584 TATGGCCAACTCATGATGGAAGG + Intronic
1055291016 9:74781815-74781837 TATGGAGAACTGACTGTGGGGGG - Intronic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1060237209 9:121873179-121873201 GATGACCACCTGACTGTGGATGG - Intronic
1062340751 9:136093000-136093022 TCTGCCCCACTGACGGTGGCTGG + Intronic
1188565935 X:31526681-31526703 TATGGGCACCAGAAGGTGGAAGG - Intronic
1192629773 X:72768399-72768421 TATGGCCATATGACCCTGGAGGG - Intergenic
1192651937 X:72952405-72952427 TATGGCCATATGACCCTGGAGGG + Intergenic
1195082260 X:101382641-101382663 TCTGGCCAACTGATGATGGAAGG + Intronic
1201958487 Y:19651504-19651526 TCAAGCCAACTGATGGTGGAAGG - Intergenic