ID: 1119518395

View in Genome Browser
Species Human (GRCh38)
Location 14:75266593-75266615
Sequence GCAGCTGCTGCCATGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 9, 3: 33, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119518395_1119518396 -3 Left 1119518395 14:75266593-75266615 CCAGGATGCATGGCAGCAGCTGC 0: 1
1: 0
2: 9
3: 33
4: 316
Right 1119518396 14:75266613-75266635 TGCCTAGTTTTTGCCTTCTCAGG 0: 1
1: 0
2: 0
3: 18
4: 225
1119518395_1119518399 13 Left 1119518395 14:75266593-75266615 CCAGGATGCATGGCAGCAGCTGC 0: 1
1: 0
2: 9
3: 33
4: 316
Right 1119518399 14:75266629-75266651 TCTCAGGAATCACTGACAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119518395 Original CRISPR GCAGCTGCTGCCATGCATCC TGG (reversed) Intronic
900593497 1:3470060-3470082 GCAGCTGCAGCCATGCACGGGGG + Intronic
901316741 1:8314903-8314925 GCAGCTTCAGCTCTGCATCCAGG + Intergenic
901569362 1:10147052-10147074 TCAGCTGCTGCTCCGCATCCTGG + Exonic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902311863 1:15587190-15587212 CCAGGTGCTGTCAAGCATCCAGG - Intronic
902507368 1:16946919-16946941 GCTGCTGCTCCAATGCCTCCTGG - Exonic
902613496 1:17610621-17610643 GCAGCTGCTGCAATGCCAGCGGG - Intronic
902931099 1:19732065-19732087 GCAGCTCCTCCCATGCAGCTGGG - Intronic
903800999 1:25968120-25968142 GCAGCTACTGCCTTCCAGCCTGG + Intronic
904039908 1:27577694-27577716 CCAGCTGCTGCCAGCCTTCCTGG - Intronic
904437918 1:30511304-30511326 GCAGATGCCGTCATGCTTCCCGG + Intergenic
904841061 1:33372245-33372267 GAGGCTGGTGCCAGGCATCCTGG - Intronic
905245951 1:36613359-36613381 GCAGCTGAGGCCATCCAGCCAGG - Intergenic
905684204 1:39897231-39897253 GCACCGGCTGCAATGCATTCTGG + Exonic
906435667 1:45794336-45794358 TCACCTTCTGCCATGCAGCCTGG - Intronic
907523968 1:55043077-55043099 GATGCTGGTGCCATGCTTCCTGG + Intronic
908090528 1:60680707-60680729 GCAGCTCCTGACATGCAGTCAGG - Intergenic
908387248 1:63654190-63654212 GCAGCTGCTGCCATTTATCAAGG + Intronic
908785130 1:67728171-67728193 GCAGCTCTTTTCATGCATCCAGG + Intronic
909941567 1:81617126-81617148 TCACCTCCTGCCATGCAACCAGG - Intronic
909958383 1:81803658-81803680 GCAGCTTCTCCCAAGCAGCCTGG + Intronic
911201229 1:95046276-95046298 TCACCTGCTGCCGTGCAGCCCGG - Intronic
911806476 1:102214764-102214786 GCAGATGCTGCCATGCTTCCTGG + Intergenic
912595498 1:110871696-110871718 AGAGCTGCTGCCATGCTTACAGG - Intergenic
914437677 1:147674105-147674127 GCAGATGATGCCATGCACCTGGG + Intergenic
916735917 1:167606934-167606956 GCAGATGCTGTTATGCTTCCTGG + Intergenic
918092865 1:181312596-181312618 GCATTTGCTGCCATGCTTTCCGG + Intergenic
918132770 1:181644008-181644030 GCACCTGCTGCCACCCAGCCAGG - Intronic
920179339 1:204122891-204122913 GCAGCAGCTGCCGAGCATCCTGG - Exonic
920255328 1:204650557-204650579 GCAGCTGGGGCCTGGCATCCAGG + Intronic
920701121 1:208218801-208218823 CCAGCTGCTGCCAGGTAGCCAGG + Intronic
920960273 1:210657273-210657295 GCAGCTGCTGCTCTTCATCCAGG - Intronic
920966706 1:210707191-210707213 GCACCTGCTCCCACCCATCCTGG - Intronic
921063818 1:211608650-211608672 GGAGCTGCTGCCAACCATCGTGG + Intergenic
921123159 1:212154131-212154153 GCAACTGCTGCAATTCATACTGG + Intergenic
921184387 1:212657232-212657254 GCAGCTCCTCCCATGTCTCCAGG + Intergenic
921587487 1:216965311-216965333 GGAGCTGCTGATAGGCATCCAGG - Intronic
921811641 1:219521383-219521405 GCAGCAGCTGCCATGGCTCAGGG + Intergenic
923077298 1:230621440-230621462 GCAGCTGCTGCCTTGGCTTCTGG + Intergenic
924181404 1:241442360-241442382 GCAGATGCTGCCATGCTTCATGG - Intergenic
924303036 1:242659173-242659195 GATGCTCCTGACATGCATCCTGG + Intergenic
924583999 1:245345829-245345851 GCAGATGCCACCATGCTTCCTGG + Intronic
1063388518 10:5632661-5632683 CCAGCTGCAGCCAAGCATCTGGG - Intergenic
1065278777 10:24113756-24113778 GAAGCCCCTGCCATGCCTCCCGG + Intronic
1066313387 10:34219914-34219936 GCAGCTGCTCCATTCCATCCTGG - Intronic
1067079151 10:43203764-43203786 ACAGCAGCTGGCTTGCATCCTGG - Intronic
1067225535 10:44373695-44373717 GATGCTGCTGCCCTGCATCCTGG + Intronic
1067319719 10:45206033-45206055 GCACCTGCTGCCAGGCCTCAGGG + Intergenic
1069168941 10:65201118-65201140 GTAGATGCTGCCATGTTTCCTGG - Intergenic
1070721535 10:78760563-78760585 GCACCTGCAGGCCTGCATCCTGG - Intergenic
1070748701 10:78951173-78951195 GCAGCTGCAGTCATGAAGCCAGG + Intergenic
1072626672 10:97116652-97116674 GAAGCAGCTGCCATGCAGTCGGG + Intronic
1072665285 10:97388311-97388333 GGACCTGCTGCCCTGCTTCCCGG - Exonic
1076016907 10:127035007-127035029 GCAGCTGTTGCCAGGCAACAAGG + Intronic
1076576913 10:131475388-131475410 GCAGATGCTGCCATGCTTTCTGG - Intergenic
1076867172 10:133173662-133173684 GGAGCTGCTGCCATCCATCTGGG - Intronic
1076992060 11:280547-280569 GCAGCGGCTGCTCTTCATCCTGG + Exonic
1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG + Exonic
1077187605 11:1242412-1242434 GCAGGTGCTGACCTGCAGCCTGG + Exonic
1077851592 11:6078632-6078654 GCAGCCGCTGCCACGCCTCCTGG + Intergenic
1078866017 11:15297954-15297976 GCAGGTGCTGCCATCCATTTGGG - Intergenic
1082009042 11:47438130-47438152 GCAGGGGCTGGGATGCATCCTGG + Intronic
1082076693 11:47980736-47980758 GCCGCCGCTGCCATGTCTCCGGG + Exonic
1082265973 11:50118911-50118933 GCAGCTGCTGTCATTCTTCGTGG - Intergenic
1082290115 11:50359661-50359683 GCAGCTGCTGTCATTCTTCGTGG + Intergenic
1083164647 11:60876059-60876081 GCAGCTGCTGTCATGGATAAGGG + Intergenic
1083291219 11:61691266-61691288 GCAGCTGGAGCAGTGCATCCTGG + Intronic
1083308488 11:61772734-61772756 GCTGCAGCTGCCAAGCTTCCTGG - Intronic
1083344164 11:61977879-61977901 TCACCTCCTGCCATGCAGCCTGG - Intergenic
1083452199 11:62753619-62753641 GCAGCTGCTGCAGAGCCTCCGGG - Exonic
1083603286 11:63961889-63961911 ACAGCTGTTGCCAGGCATCCAGG - Intergenic
1084853757 11:71966523-71966545 GGAGCTGCTGCCCTCCAGCCTGG - Intronic
1085051653 11:73383101-73383123 GCAGCTGCTGCCTGGCCTCGAGG + Intronic
1086365773 11:86109189-86109211 GCAGATGCTGCCATGCTTCTGGG - Intergenic
1088814702 11:113413040-113413062 GCAGGGGCTGCCATGGGTCCTGG - Intronic
1089700473 11:120241100-120241122 GCAGGAGCTGCCAGGCAGCCAGG + Intronic
1091250471 11:134140054-134140076 CCTGCTGATGCCATGCTTCCAGG - Intronic
1092346858 12:7722557-7722579 ACAGCTGCTGCACTGCAGCCTGG + Intergenic
1093910962 12:24747067-24747089 CCAGCTGCTGCCTTCCCTCCAGG - Intergenic
1096595515 12:52692563-52692585 GCAGCTTCTGCCACGCATCCTGG + Exonic
1097926631 12:65135099-65135121 GCAGCTAATGCCATGAAACCAGG - Intergenic
1098981720 12:76963257-76963279 GCAGCTCCTACCACTCATCCTGG + Intergenic
1099187553 12:79532596-79532618 GCAGCTGCTGTCAGCCATACGGG - Intergenic
1101691978 12:107091470-107091492 GAAGCTGTTGGCATTCATCCAGG - Intronic
1101735127 12:107457706-107457728 GCAGCTGAGGCCATGCCTCCAGG - Intronic
1103768101 12:123297516-123297538 CCAGTTGCTGCCCTGCTTCCTGG + Intronic
1105204774 13:18211837-18211859 CCAACTGCTGCCATGCAGACAGG - Intergenic
1105204959 13:18214868-18214890 CCAACTGCTGCCATGCAGACAGG - Intergenic
1106621725 13:31376927-31376949 GTAGCTGCTGGCATCCAACCCGG - Intergenic
1107058519 13:36131240-36131262 GCAGCTGCTGCCGCCCAGCCCGG - Exonic
1107922606 13:45225471-45225493 GCACCTGCTGCCATGATGCCCGG - Intronic
1109962344 13:69646732-69646754 GCAGATGCTGCCATGCTTCCTGG + Intergenic
1113408396 13:110062692-110062714 GCAGCATCTGCCATGCATGATGG + Intergenic
1114676015 14:24440815-24440837 GAAGCTGCAGCCAGGCTTCCTGG - Exonic
1116202721 14:41819565-41819587 GAAGATGATGCCATGCTTCCTGG - Intronic
1117636890 14:57753707-57753729 GGAGCTGCTGCCCTTCTTCCAGG + Intronic
1118451321 14:65905089-65905111 GAAGCTGCTGCCCTCAATCCAGG + Intergenic
1118841798 14:69519036-69519058 TCAGCTGCTGCCTGGCTTCCTGG - Intronic
1119245199 14:73098684-73098706 GCAGCTGCTGCACTCCAGCCTGG - Intronic
1119518395 14:75266593-75266615 GCAGCTGCTGCCATGCATCCTGG - Intronic
1120141039 14:80929914-80929936 TCACCTGCTGCTCTGCATCCCGG - Intronic
1120557603 14:85948305-85948327 GCAGAAGCTGCTATGCTTCCTGG - Intergenic
1121206384 14:92172001-92172023 GCAGGTGCTGTCATGGATCGAGG - Exonic
1122121922 14:99559091-99559113 GCAGGTGCTGCCATGCTTCCTGG + Intronic
1202849814 14_GL000225v1_random:9416-9438 GGAGCAGATGCAATGCATCCTGG + Intergenic
1124439358 15:29675277-29675299 GCAGCTGCTGCCGGGGGTCCTGG + Intergenic
1124853217 15:33361120-33361142 CCAGCTGCTGACCTGGATCCAGG - Intronic
1125727397 15:41875038-41875060 CCAGCTGCTCCTTTGCATCCTGG + Exonic
1128010739 15:64293670-64293692 TCACCTCCTGCCATGCAGCCTGG - Intronic
1129695608 15:77739156-77739178 CCAGCTGTTGGCAGGCATCCTGG - Intronic
1129777225 15:78244701-78244723 CCAGCTGTTCCCAAGCATCCAGG - Intronic
1131260488 15:90884991-90885013 CCAGCTGCTGCCTTGCCTCCAGG + Intronic
1131321585 15:91398786-91398808 GCAGCTGAAACCTTGCATCCAGG - Intergenic
1134002176 16:10791503-10791525 ACAGCTGCTGGCATTCACCCTGG - Intronic
1134804262 16:17111526-17111548 GCAGCTGCTGTCAGGCAAACAGG - Intronic
1135205157 16:20477408-20477430 GCAGCCGTTCCCATGTATCCTGG - Exonic
1135213742 16:20546413-20546435 GCAGCCGTTCCCATGTATCCTGG + Exonic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1140471601 16:75218634-75218656 CCAGCTGCTGTCATGGAACCAGG - Intergenic
1141769983 16:86083908-86083930 GCCCCAGCTGCCATGCATGCAGG - Intergenic
1142128964 16:88423778-88423800 GAAGCAGCTGCCATGCTTTCCGG - Intergenic
1142427149 16:90007256-90007278 CCAGCTGCTCCCATGGTTCCTGG - Intronic
1143166423 17:4899354-4899376 GGAGCTGCTGCCGCGCCTCCTGG - Exonic
1143502568 17:7347777-7347799 GCCGCAGCTGCCCTGCCTCCTGG + Intronic
1145198988 17:20922661-20922683 GCAGCTGCTGCATAGCATCTTGG + Intergenic
1147952403 17:44114446-44114468 GGGGCTGCTGCCCTCCATCCTGG + Intronic
1150220420 17:63492929-63492951 TCTGCAGCTGCCATTCATCCTGG + Intronic
1151415629 17:73960875-73960897 GCAGCTTCTGCCAGGCACCCAGG - Intergenic
1151457219 17:74233199-74233221 GTAGCTGCTGCCTTGCCTCCAGG + Intronic
1151757107 17:76081375-76081397 GCAGCTGGTGCCCTGCTTCCAGG + Exonic
1152087131 17:78227189-78227211 GCAGCACCTGCCCAGCATCCTGG - Intergenic
1152128682 17:78462782-78462804 GCAGCTCCTGCGAGGCCTCCAGG + Intronic
1152147307 17:78576108-78576130 GCAGCTGCTGAAAAGCATCAGGG + Intronic
1152177230 17:78795759-78795781 ACAGGTGCGGCCATGCAACCAGG + Exonic
1152229789 17:79108734-79108756 GCACCTGCTGCCCTGGAGCCTGG - Intronic
1152279438 17:79376643-79376665 GGAGCTGCTGTCTTGCAGCCAGG + Intronic
1152340406 17:79721108-79721130 TCAGCGGCTGCCTTGCCTCCCGG - Intergenic
1152726919 17:81952136-81952158 GCAGCTGGTGCCATCCGCCCTGG + Intergenic
1157532372 18:48432236-48432258 GCAGAAGCTGCAAGGCATCCTGG + Intergenic
1157692803 18:49697783-49697805 GCAGCTGTTCCCATGCAATCAGG - Intergenic
1161579977 19:5075354-5075376 GCAGCTGCTGCCGGGAAGCCGGG + Intronic
1164792819 19:31002590-31002612 GCAGCAGCTGCAAAGCATCAAGG - Intergenic
1165008993 19:32829769-32829791 TCAGCTCTTGCCATTCATCCTGG + Intergenic
1166102068 19:40576891-40576913 GCCGCTGCTGCCATGGCCCCCGG - Exonic
1166291473 19:41866374-41866396 GCAGCTGCTGCCATCCCTCTGGG - Intronic
1166685190 19:44792489-44792511 GCAGCTGCTGCCTGGCTGCCTGG + Exonic
1166781979 19:45347760-45347782 CCAGCTGGTGGGATGCATCCTGG - Intronic
1166817624 19:45556398-45556420 GGAGCCGCTGCCTTCCATCCTGG - Intronic
1167149147 19:47698993-47699015 GCAGCTGCTGAAACGCACCCAGG + Exonic
1167494536 19:49809837-49809859 GCAGCAGCTACCGTTCATCCAGG + Intronic
1168453787 19:56488204-56488226 GCACCTGCTGCCTTGTATCTAGG - Intergenic
1168467349 19:56613850-56613872 CCAGCTGCTGCCACTCCTCCTGG - Intronic
925032359 2:660828-660850 GCGGCTTCTGCCTTACATCCCGG - Intergenic
925104341 2:1277739-1277761 GCAGCTGGTGACATGCAAGCTGG + Intronic
927139857 2:20122531-20122553 GCACCGGCTCCCATGCATGCGGG - Intergenic
927909103 2:26884048-26884070 GCTGCAGCTGCCATCCTTCCAGG + Intronic
929047866 2:37807942-37807964 GAAGCTGCTGGTATCCATCCTGG + Intergenic
929824717 2:45301172-45301194 GCAGCTGAGTCCAAGCATCCAGG + Intergenic
930056669 2:47257608-47257630 GCAGCTGCTGCCCTCCATAAAGG - Intergenic
931090815 2:58884022-58884044 GCAGCTCCTGCCAGGCATGCAGG - Intergenic
931636643 2:64346563-64346585 GCAGCTGCCCACATGCAACCTGG - Intergenic
932789361 2:74640265-74640287 GGTTTTGCTGCCATGCATCCTGG - Exonic
934779421 2:96960337-96960359 TCACCCCCTGCCATGCATCCTGG - Exonic
935123263 2:100200109-100200131 GCAGATGCCGCCGTGCTTCCTGG + Intergenic
935208080 2:100913963-100913985 CCAGCTACAGCCATGCATCTTGG + Intronic
936349708 2:111703444-111703466 GGAGCTGCTGTCAAGCTTCCCGG - Intergenic
936663801 2:114571404-114571426 GCAGATGCTGTCATGCTTCCTGG + Intronic
937120233 2:119435879-119435901 GCAGCTCCTGCCACCCCTCCAGG - Intronic
937222819 2:120351887-120351909 GAAGCTGCTGGCATCCAACCTGG - Intergenic
939755375 2:146103008-146103030 GCAGCTGGTGCCACCCATACCGG - Intergenic
943236821 2:185332341-185332363 GCTGCCACTGCCATGCAACCTGG - Intergenic
947028878 2:225770189-225770211 GCTGCTGCTGCACTGCAGCCAGG + Intergenic
947877078 2:233474586-233474608 CCACGTGCTGCCATGCGTCCAGG - Intergenic
948257333 2:236577799-236577821 GCAGAAGCTGCCATAAATCCTGG - Intronic
1168795660 20:608968-608990 GCAGCTCCTGCAATGTGTCCTGG - Intronic
1168831666 20:848442-848464 GCAGCTGCTGCCCTGTCTCCTGG + Intronic
1169075808 20:2759272-2759294 GCAGCTGTTCCCATGGAGCCCGG + Exonic
1171248683 20:23633050-23633072 GCACCTGCTGTCATCCATCCTGG - Intronic
1174147691 20:48463553-48463575 GCAGCTGGTGCCCTTCATCTGGG + Intergenic
1174337710 20:49874911-49874933 GGAGCTGCTGCCCTGCTGCCAGG - Intronic
1175519406 20:59590407-59590429 GCAGATGCAGCCAGTCATCCTGG + Intronic
1175744202 20:61442713-61442735 GGAGCTGCTTCAGTGCATCCCGG - Intronic
1176007793 20:62875582-62875604 GGAACTGCTGCCATGCAGCTGGG + Intergenic
1176386461 21:6140592-6140614 GCAGCTGCTGCCAGCCAGGCAGG + Intergenic
1177725622 21:24963268-24963290 GCAGAAGCTGCTATGCCTCCTGG + Intergenic
1178407938 21:32339851-32339873 GCAGCTGTTCTCATGCCTCCTGG - Intronic
1178662820 21:34521436-34521458 ACAGCTGCTGCCCTGCACCAGGG - Intronic
1179737012 21:43397660-43397682 GCAGCTGCTGCCAGCCAGGCAGG - Intergenic
1179826468 21:43968851-43968873 GCAGAGGCTGCCAGGCTTCCGGG - Intronic
1180760797 22:18202538-18202560 CCAACTGCTGCCATGCAGACAGG + Intergenic
1180760883 22:18203382-18203404 CCAACTGCTGCCATGCAGACAGG + Intergenic
1180760993 22:18205978-18206000 CCAACTGCTGCCATGCAGACAGG + Intergenic
1180764447 22:18236887-18236909 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180764534 22:18237749-18237771 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180771107 22:18386589-18386611 CCAACTGCTGCCATGCAGACAGG + Intergenic
1180774676 22:18418808-18418830 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180774786 22:18421278-18421300 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180774872 22:18422122-18422144 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180788228 22:18558662-18558684 GGAGCTGCTGGCCGGCATCCAGG - Intergenic
1180807837 22:18730027-18730049 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180807949 22:18733829-18733851 CCAACTGCTGCCATGCAGACAGG - Intergenic
1180819063 22:18812880-18812902 GCAGCTTCTGCCAGCAATCCTGG + Intergenic
1180829377 22:18893066-18893088 CCAACTGCTGCCATGCAGACAGG + Intergenic
1181070876 22:20338791-20338813 CCAACTGCTGCCATGCAGACAGG - Intergenic
1181193774 22:21166004-21166026 CCAACTGCTGCCATGCAGACAGG - Intergenic
1181193858 22:21166889-21166911 CCAACTGCTGCCATGCAGACAGG - Intergenic
1181193945 22:21167744-21167766 CCAACTGCTGCCATGCAGACAGG - Intergenic
1181205287 22:21247328-21247350 GCAGCTTCTGCCAGCAATCCTGG + Intergenic
1181215496 22:21325034-21325056 CCAACTGCTGCCATGCAGACAGG + Intergenic
1181215582 22:21325887-21325909 CCAACTGCTGCCATGCAGACAGG + Intergenic
1181215667 22:21326736-21326758 CCAACTGCTGCCATGCAGACAGG + Intergenic
1181233510 22:21436656-21436678 GGAGCTGCTGGCCGGCATCCAGG + Intronic
1181245140 22:21498187-21498209 GGAGCTGCTGGCCGGCATCCAGG - Intergenic
1181525918 22:23487085-23487107 CCAACTGCTGCCATGCAGACAGG + Intergenic
1181737297 22:24892102-24892124 GCTGCTGGGGCCATGCATCTAGG + Intronic
1182836415 22:33345541-33345563 GCAGGAGCTGCCAAGCATCAGGG + Intronic
1183164334 22:36136100-36136122 GCAGCTCCTTCCAGGCAGCCTGG - Intergenic
1183373215 22:37447483-37447505 GCAGCTGCAGCCATGGAGCTGGG + Intergenic
1183489219 22:38107913-38107935 ACAGCTGCATCCATGCCTCCAGG - Exonic
1183678303 22:39312134-39312156 GCAGCTGCACCCCAGCATCCTGG + Intergenic
1184608791 22:45589676-45589698 GCAGCGGCTCCCATGGCTCCAGG + Intronic
1184892419 22:47388153-47388175 GCACCCTCTGCCATGCACCCAGG - Intergenic
1184942146 22:47776848-47776870 GCAGCTGCGGGAATGCAGCCTGG - Intergenic
1185172589 22:49302449-49302471 ACAGATGCTTCCATGCTTCCTGG - Intergenic
1185310893 22:50153635-50153657 GCAGCTGCTGCCTTCCCTGCCGG - Intronic
1185330529 22:50250233-50250255 GCAGCTGGTGTCTTGCAGCCTGG - Intronic
1185384665 22:50526276-50526298 GCAGCTGCTGCCTCGCGCCCGGG - Exonic
1203221638 22_KI270731v1_random:48087-48109 GCAGCTTCTGCCAGCAATCCTGG - Intergenic
1203232943 22_KI270731v1_random:127753-127775 CCAACTGCTGCCATGCAGACAGG + Intergenic
1203233031 22_KI270731v1_random:128627-128649 CCAACTGCTGCCATGCAGACAGG + Intergenic
1203269188 22_KI270734v1_random:38733-38755 GCAGCTTCTGCCAGCAATCCTGG + Intergenic
1203279467 22_KI270734v1_random:118371-118393 CCAACTGCTGCCATGCAGACAGG + Intergenic
949772797 3:7597118-7597140 GCAAATGTTGCCATGCTTCCTGG - Intronic
950677009 3:14560404-14560426 GCTGCTCCTTCCCTGCATCCAGG + Intergenic
952688231 3:36174007-36174029 GCATCTGCTGCCATACATATTGG + Intergenic
953237362 3:41118462-41118484 GCAGATGCTGCCATGCTTCCTGG - Intergenic
953296011 3:41717728-41717750 GCAGGAGCTGCCACGAATCCTGG - Exonic
954330835 3:49889491-49889513 GCAGCTGCCGCCATCCCTCCAGG + Intronic
955755646 3:62222792-62222814 AGAGTTCCTGCCATGCATCCTGG + Intronic
956544917 3:70390449-70390471 CCAGATGCTGCTATGCTTCCTGG - Intergenic
956901622 3:73722369-73722391 TCACCTGCTGCTATGCAGCCTGG - Intergenic
957486609 3:80870554-80870576 GCAGCTGCTGCTGTGGACCCAGG + Intergenic
960160937 3:114350236-114350258 GCCCCTGCTGCCAGGCCTCCAGG + Intronic
960604371 3:119489739-119489761 TCACCTCCTGCCATGCAGCCTGG - Intronic
962669739 3:137692974-137692996 GCAGCTGCTGCTCAGCTTCCAGG - Intergenic
962791524 3:138815907-138815929 GCAGTTGCTGCCATGTATTGAGG - Intronic
963788952 3:149563793-149563815 GGAGCTGCTGCACTGCAGCCTGG - Intronic
965782504 3:172301812-172301834 GCAGCTGCTGCACTCCAGCCTGG + Intronic
966400024 3:179538461-179538483 GCAGATGCTGCTGTGCTTCCTGG - Intergenic
967392573 3:188971684-188971706 GCAGCTGCTGAGAGGCACCCAGG - Intronic
968066332 3:195761697-195761719 GCACCTGCTGTCAGGCCTCCAGG + Intronic
968735279 4:2291910-2291932 GCAACTCCTGCCCTGCAGCCCGG - Intronic
968984458 4:3867537-3867559 TCACCTGCTACCTTGCATCCTGG - Intergenic
969463234 4:7339909-7339931 GCAGCAGCTGCCATGCATCAGGG + Intronic
974967472 4:68779550-68779572 GCTGCTGCTGCACTGCAGCCTGG - Intergenic
975913472 4:79297100-79297122 GCCTCTGCTGCTCTGCATCCTGG + Intronic
976285094 4:83363588-83363610 GCAGCAGCTGCCCTGGATCAAGG - Intergenic
977048416 4:92095524-92095546 CCAGCTGCTGCCATTCTCCCTGG - Intergenic
978409836 4:108415312-108415334 TCAGCTGGTGCCCTGCTTCCAGG + Intergenic
979398492 4:120218625-120218647 GAGGCTGGTGCCATGCTTCCTGG + Intergenic
982982905 4:162164036-162164058 GGAGCTGCTGCCACTCAACCCGG + Intergenic
985004963 4:185525143-185525165 GCAGCTGCCGCCTTGCTTCCTGG + Exonic
987188246 5:15446539-15446561 GGAGATGGTGCCATGCATCCTGG - Intergenic
991482825 5:67101414-67101436 GCAGCTGATGCCATCCCTGCAGG + Intronic
991994091 5:72370327-72370349 GCAGCAGCAGCCTTGGATCCTGG - Intergenic
992775621 5:80086053-80086075 GCACCTGCTCCCATGCCCCCAGG - Intergenic
993779725 5:92051305-92051327 GCAGCTGAGGCCATTGATCCAGG + Intergenic
995050448 5:107697250-107697272 GCAGCTTCTCCCAGGCTTCCAGG - Intergenic
996676662 5:126183104-126183126 GCAAATGCCGTCATGCATCCTGG + Intergenic
997580514 5:135013931-135013953 GCAGGTGCTGCCATGCCTCCTGG - Intergenic
997670654 5:135669242-135669264 TCAGCCTCTGTCATGCATCCTGG + Intergenic
998920411 5:147061733-147061755 GCAGCTGCTACCATGCAGCAGGG + Intronic
1000957297 5:167558465-167558487 GCCACTCCTGCCATGCAGCCGGG - Intronic
1001600233 5:172923699-172923721 GGAGCAGCTGCCATGAGTCCTGG + Intronic
1001907646 5:175486336-175486358 CCAGCATCTGCCATGCAACCTGG + Intronic
1002134829 5:177101038-177101060 CCAGCTGCTGCCATGCTGCCGGG - Intergenic
1002943540 6:1739347-1739369 GCGGCTCCTGGCATGCCTCCAGG + Intronic
1004976528 6:20973548-20973570 TCAGCTGCTGCCATCCTGCCAGG + Intronic
1006030012 6:31171505-31171527 GCAGATGGTGCCAGGCACCCAGG - Intronic
1006300154 6:33189644-33189666 GCTGATGCTGCCCTGCCTCCAGG - Intronic
1006744193 6:36330110-36330132 GCAGCTGCTGCCTTGCGCTCCGG - Exonic
1006922040 6:37633570-37633592 GCAGCTGCTGCCCTTCTCCCAGG - Exonic
1007943087 6:45800389-45800411 ACAGCTGCTGCCCTACATCCTGG + Intergenic
1008077092 6:47156305-47156327 CCAGCAGTTGCCATGCATCAGGG - Intergenic
1008628883 6:53345200-53345222 GCAGCTGCTGTCAGTCATCTTGG + Intronic
1010813939 6:80332820-80332842 GCAGCTCATGCCCTGCATGCAGG + Intronic
1014007296 6:116434905-116434927 GCAGATGATGCCATGCTTCTTGG - Intronic
1014009803 6:116462379-116462401 GCCGCTGGTGCCGTGCAACCAGG + Exonic
1014100534 6:117506679-117506701 GCAGCTGTTGCCCAGCTTCCTGG + Intronic
1014282878 6:119461363-119461385 GATGCTGATGCCATGCATCTTGG + Intergenic
1015663549 6:135602918-135602940 GCAGCGGCTGCCATCAATCCTGG + Intergenic
1015992269 6:138958398-138958420 GCACGTTCTGCCATGTATCCTGG - Intronic
1016164219 6:140920005-140920027 ACTGCTGCTGCCCGGCATCCTGG + Intergenic
1016543591 6:145195262-145195284 GCCTCTGCAGCCATGCTTCCTGG - Intergenic
1017202642 6:151772627-151772649 GCAGCTGCTCCCATCCTTCTTGG - Intronic
1018339182 6:162831518-162831540 GCACATCCTGCCATGTATCCTGG - Intronic
1019323148 7:424706-424728 GCAGGTGCTGACGTGCACCCAGG - Intergenic
1020047942 7:5057333-5057355 CCAGCTGCTGCCACTCCTCCTGG - Exonic
1020287678 7:6697751-6697773 CCAGCTGCTGCCATTCCTCCTGG + Exonic
1021270133 7:18574909-18574931 GCAGCTGCAGCTATGGACCCAGG - Intronic
1023991590 7:45132051-45132073 GGAGCTGCTGCCAGGGATGCAGG - Intergenic
1025009251 7:55382693-55382715 CCAGCTGGTGCCATCCAGCCTGG - Intronic
1025168772 7:56737061-56737083 GCAGCTGCTGCACTCCAGCCTGG + Intergenic
1025703618 7:63842851-63842873 GCAGCTGCTGCACTCCAGCCTGG - Intergenic
1026364568 7:69634815-69634837 CCAGCTGCTGCCATTCAAACAGG + Intronic
1027144967 7:75688162-75688184 GCAGGTGCTGTGTTGCATCCAGG - Intronic
1028023971 7:85813519-85813541 GCTGCTCCAGCCATGCTTCCTGG - Intergenic
1030658091 7:112190474-112190496 GCAACTGCTGAAATGCTTCCTGG - Intronic
1031960860 7:127988594-127988616 GCAGTTGCTCCCCTGAATCCTGG - Intronic
1032374295 7:131394566-131394588 GCACCTCCTGCCATGCGTCTGGG + Intronic
1032513106 7:132487674-132487696 CCAGTTGCTGCCAGGAATCCTGG - Intronic
1032658427 7:133955997-133956019 GCAGCTGCTGCCACCCAAACTGG - Intronic
1032858873 7:135859081-135859103 GGAGCTGCTGCCATGGGGCCAGG - Intergenic
1033477265 7:141702546-141702568 GCAGCTTCTGCCACACATCCAGG - Intergenic
1034523454 7:151638990-151639012 GCAGCTCCTGTCCAGCATCCAGG - Intronic
1035016624 7:155772232-155772254 GCTGCTGCAGCCGTGCCTCCGGG - Intronic
1035070022 7:156137787-156137809 GGAGCTGCAGACAGGCATCCGGG - Intergenic
1035367319 7:158357677-158357699 GCAGCCACTGCCAAGCAACCGGG + Intronic
1035825335 8:2639090-2639112 GCAGCTTCTGCCTGGCCTCCTGG + Intergenic
1037154643 8:15684809-15684831 ACAGCTGCTGCTTTACATCCAGG - Intronic
1037816847 8:22116964-22116986 GCCGCCGCAGCCCTGCATCCAGG + Exonic
1039021091 8:33207428-33207450 GCAGCTGCTAACAAGCCTCCAGG - Intergenic
1039988421 8:42467512-42467534 GCTGCTGCTGCCAGGCAACCAGG - Intronic
1040425954 8:47286539-47286561 ACAGCTGCTGCAGTCCATCCTGG + Intronic
1040627161 8:49161935-49161957 GCAGCTTCTGGCATGCTACCAGG - Intergenic
1040739730 8:50558227-50558249 GCAGCTGCTGCCATGGAGCCTGG - Intronic
1042458260 8:69030786-69030808 GCAGCTGCTGCCATGCTCCCAGG + Intergenic
1043097993 8:75999957-75999979 TCACCTGCTGCTGTGCATCCCGG + Intergenic
1045800540 8:106096333-106096355 ACAGCTGCTGCCAGGGATGCAGG - Intergenic
1046556484 8:115779565-115779587 GCAGCCGCTGAAAAGCATCCTGG + Intronic
1047088567 8:121547430-121547452 GCAGTTGCTGCCATGCCCCAAGG - Intergenic
1048995418 8:139791008-139791030 GAAGATACTGCCATGCTTCCTGG + Intronic
1049302839 8:141880691-141880713 GCAGCTGCCTTCATGCAGCCTGG + Intergenic
1049763775 8:144343484-144343506 GCAGCTGCAGCCATCCCTCAAGG - Intergenic
1049918502 9:341762-341784 TCACCTCCTGCCATGCAGCCTGG - Intronic
1050598645 9:7228779-7228801 GCTGATGCAGCCATACATCCAGG - Intergenic
1053511063 9:38688098-38688120 GGAGCTGCTGCCAGTCACCCCGG - Intergenic
1055375902 9:75648166-75648188 GCAGCTGCTGCCAGGGCCCCAGG - Intergenic
1056290331 9:85136648-85136670 GCAGCTGCAGCAATCCACCCTGG + Intergenic
1057016456 9:91656929-91656951 TCAGCATCTGCCCTGCATCCAGG - Intronic
1057054421 9:91949915-91949937 GCGGCCGCTGCTGTGCATCCCGG - Exonic
1058536705 9:105968154-105968176 GCAGCTGCAGACATGAATACAGG - Intergenic
1060723966 9:125995367-125995389 GCCGCTGCCTCCATCCATCCTGG + Intergenic
1061586914 9:131575444-131575466 GCAGCTGCTGCGACCCACCCTGG - Intergenic
1061614666 9:131772057-131772079 GCAGCAGCAGCCCTGCTTCCAGG - Intergenic
1062167946 9:135117711-135117733 GCAGCTGCTGCCCCACAACCTGG + Intronic
1186475784 X:9856735-9856757 GCAGCAGCTACCATGCAACTGGG - Intronic
1186503058 X:10067429-10067451 GCAGCTGCTGGTATTCCTCCTGG - Exonic
1186646279 X:11510523-11510545 AAAGCTGCTGCCACCCATCCTGG + Intronic
1189257119 X:39649017-39649039 GCAGCAGCTGCAATGCATGCTGG + Intergenic
1189899330 X:45689740-45689762 GATGCTGGTGCCATGCTTCCTGG + Intergenic
1190065895 X:47241597-47241619 GGAGCTGCTGTCATTCCTCCTGG + Exonic
1190585066 X:51931992-51932014 GCACATGCTGCTATGCTTCCAGG - Intergenic
1194385084 X:93242776-93242798 GCAGCTGCGGCCATGTCTCCAGG - Intergenic
1196674611 X:118406232-118406254 GCAGGTCCTGCCATGGATACTGG + Intronic
1196857696 X:119999581-119999603 GCTGCTGCTGCCAGGGCTCCTGG + Intergenic
1196859591 X:120014929-120014951 GCTGCTGCTGCCAGGGCTCCTGG + Intergenic
1197796101 X:130299845-130299867 GCAGCTGCAGCCATGCTCCTAGG - Intergenic
1202028284 Y:20547765-20547787 GCAGCTGCAGGCATGTCTCCAGG + Intergenic