ID: 1119520081

View in Genome Browser
Species Human (GRCh38)
Location 14:75278735-75278757
Sequence CAACCACGGTGGCGCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119520081_1119520088 28 Left 1119520081 14:75278735-75278757 CCCCTCTGGCGCCACCGTGGTTG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1119520088 14:75278786-75278808 AACGCTTGTTATAAAAGCAGTGG 0: 1
1: 0
2: 1
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119520081 Original CRISPR CAACCACGGTGGCGCCAGAG GGG (reversed) Intergenic
901020929 1:6255049-6255071 CTACAACGCTGTCGCCAGAGAGG - Intronic
903456151 1:23488333-23488355 CAATCACAGTGGGGACAGAGAGG - Intergenic
917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG + Intronic
920785004 1:209032981-209033003 AAACTACGGTGGAGGCAGAGGGG + Intergenic
922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG + Intergenic
1069688549 10:70334804-70334826 CAACCGCCTTGGTGCCAGAGGGG - Intronic
1074919602 10:117993571-117993593 CAGAGATGGTGGCGCCAGAGGGG + Intergenic
1076935564 10:133566151-133566173 CCTCCACGGTGGCCCCAGCGCGG - Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077200647 11:1305837-1305859 CCACCGCGGTGCCGTCAGAGAGG - Intronic
1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG + Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084657424 11:70527612-70527634 CCACCACGGGGGCTCCAGGGAGG - Intronic
1092615454 12:10212419-10212441 CAAACACTGTGACGCCAGCGCGG + Intergenic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG + Exonic
1100665278 12:96745259-96745281 CAACCACTGTGGAGACAGTGTGG - Intronic
1101481963 12:105107337-105107359 CTCCTACGGTGGCGACAGAGAGG + Intronic
1103688722 12:122753072-122753094 CAACCCCGGGGACGCCAGAAGGG - Intronic
1105505717 13:21008080-21008102 TCCCCACGGTGGAGCCAGAGTGG - Intronic
1112169068 13:96950950-96950972 CAACTAAGGTAGTGCCAGAGTGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG + Intronic
1131369108 15:91865029-91865051 CAACCACGGAGGGGGCAGAAAGG - Intronic
1132408358 15:101558724-101558746 AAATCAGGGTGCCGCCAGAGGGG + Intergenic
1139016218 16:62692192-62692214 CTACCATGGTGGCACTAGAGGGG - Intergenic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1144669411 17:17124559-17124581 GAACCACTGTGGAGGCAGAGGGG - Intronic
1149546719 17:57509389-57509411 CAACCAAGATGACGCCAGACTGG - Intronic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1151914446 17:77107143-77107165 CAACCACCGTGGACCCACAGGGG + Intronic
1160955073 19:1687512-1687534 AAACCACGGAGGGGTCAGAGAGG + Intergenic
1168270148 19:55245457-55245479 AACCCACGGTGGCGCCAGGGTGG + Intronic
925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG + Exonic
934566174 2:95342790-95342812 CAATCACTGTGGCAGCAGAGGGG + Intronic
1171087050 20:22247209-22247231 CAACCACGGAGGTGCCAAGGGGG - Intergenic
1171892016 20:30725278-30725300 CAACCACCATGGCCCCTGAGAGG - Intergenic
1172177322 20:32980294-32980316 CACCCACAGGGCCGCCAGAGTGG - Intergenic
1172245459 20:33442893-33442915 CAACCAAGGTGGGTGCAGAGGGG - Intronic
1178485376 21:33016397-33016419 TGACCACGGTGGCGCTACAGGGG - Intergenic
1179273129 21:39866750-39866772 CAACCACAGTGGGGCCAGGAAGG - Intergenic
1179627270 21:42655781-42655803 CAAACAGGGAGGCGCCAGACGGG + Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1180820318 22:18822688-18822710 GAACCAAGGTGACGGCAGAGAGG + Intergenic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1203220377 22_KI270731v1_random:38263-38285 GAACCAAGGTGACGGCAGAGAGG - Intergenic
1203270448 22_KI270734v1_random:48563-48585 GAACCAAGGTGACGGCAGAGAGG + Intergenic
952985857 3:38782346-38782368 AAACCACGGTGCCTCCAGAGGGG - Intronic
954147286 3:48640702-48640724 CAACCCTGGTGGTCCCAGAGAGG + Intronic
956606294 3:71076188-71076210 CAGCCACCCTGGCTCCAGAGAGG + Intronic
967916772 3:194584146-194584168 CATCCACGATCGTGCCAGAGGGG - Intergenic
968947553 4:3673401-3673423 AGACCACGGTGCCCCCAGAGTGG - Intergenic
978343068 4:107738020-107738042 CCACCACGGTGGTGCTAGAAAGG - Intergenic
985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG + Intergenic
987029676 5:13964293-13964315 CAACCGTGGAGGAGCCAGAGGGG - Intergenic
994732378 5:103507871-103507893 CACCCACCATGGTGCCAGAGGGG + Intergenic
998261177 5:140633015-140633037 CAACCCCTGTGGCTCCCGAGTGG + Intronic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1008524774 6:52397047-52397069 AAGCCAAGGTGGGGCCAGAGAGG + Intronic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1013819674 6:114139282-114139304 CAACCACAGTAGCCCAAGAGTGG - Intronic
1016694211 6:146973966-146973988 CAAGAAGGGTGGCTCCAGAGTGG - Intergenic
1031497329 7:122466404-122466426 AAAACACTGTGGCCCCAGAGGGG - Intronic
1035328066 7:158077596-158077618 CACCCTCCGTGGCGCCCGAGAGG + Intronic
1041147595 8:54893966-54893988 CAACCACGGTGACCCCACAGTGG - Intergenic
1041401640 8:57451353-57451375 CAACTAGGGTGGAGCCTGAGGGG + Intergenic
1050171555 9:2824749-2824771 CACACACGATGGCGCCAGAGTGG - Exonic
1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG + Intergenic
1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054368490 9:64368207-64368229 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054528233 9:66154300-66154322 CAACCACTATGGCCCCTGAGCGG - Intergenic
1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG + Intergenic
1056923577 9:90813462-90813484 CAACCACTCTGCCCCCAGAGAGG - Intronic
1192213307 X:69141300-69141322 CAACCTCAGTGGCATCAGAGTGG - Intergenic
1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG + Intergenic
1194709720 X:97220539-97220561 ATACCAGGGTGGGGCCAGAGGGG + Intronic