ID: 1119520097

View in Genome Browser
Species Human (GRCh38)
Location 14:75278868-75278890
Sequence GTTCGCTGCGCCGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119520097 Original CRISPR GTTCGCTGCGCCGCGGCCGC CGG (reversed) Exonic
900112293 1:1013495-1013517 GTTCGCTGCCTCTCAGCCGCCGG - Exonic
902067465 1:13700206-13700228 GATGGCGGCGGCGCGGCCGCGGG + Intronic
903016786 1:20366680-20366702 GGTCGCGGCGCGGCGTCCGCGGG - Intergenic
903115791 1:21177205-21177227 GTTCGCTGAGCCCCGCTCGCAGG + Intergenic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
1065215088 10:23440181-23440203 GATCGCTGCGACGCGCCCGGTGG + Exonic
1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG + Intergenic
1067596873 10:47565476-47565498 GGTCGCTGGGCCCGGGCCGCCGG - Intergenic
1067705655 10:48604895-48604917 GTTCGGGGCCCCGTGGCCGCTGG + Exonic
1076372405 10:129963982-129964004 CTTCGAAGCGCCGCCGCCGCCGG - Intergenic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1083160806 11:60853006-60853028 GGTTGCAGCACCGCGGCCGCCGG - Exonic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119756716 14:77125028-77125050 GTTGGCTGCGCGGGGACCGCGGG - Intronic
1121279357 14:92688030-92688052 GTTCGCGGTGGAGCGGCCGCAGG + Exonic
1125677589 15:41511220-41511242 CTTGGCTGGGCCGCGGCCGGCGG - Exonic
1127117582 15:55743186-55743208 GTGGACAGCGCCGCGGCCGCGGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG + Exonic
1142037164 16:87869452-87869474 GCTCGCTGGGCCGCGGCTCCCGG - Exonic
1142664742 17:1456174-1456196 GTCCGCTGGGCGGCGGGCGCCGG - Exonic
1143524200 17:7462900-7462922 GTGGGCTGCCCCGAGGCCGCCGG - Exonic
1144787500 17:17840190-17840212 ATTGGCTGCGCCGGGCCCGCGGG - Intergenic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155507829 18:26549170-26549192 GCCCGCTGCGCCCTGGCCGCGGG - Exonic
1157464293 18:47930773-47930795 GTGCGTGGCGCCGCGGCGGCCGG - Intronic
1158653564 18:59308640-59308662 GTTCCTAGCGCCGCGGCCACTGG - Intronic
1160730505 19:639804-639826 GTTCGCTGGGGCGGGGACGCCGG - Intergenic
1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG + Intronic
1161101507 19:2424171-2424193 GTTCCCGGCGCCGCAGCCACAGG - Exonic
932812046 2:74834009-74834031 ATTGGCTGCGCCACGGCGGCGGG + Exonic
945119582 2:206443796-206443818 GCTAGCTGCGGGGCGGCCGCGGG - Exonic
948216713 2:236237814-236237836 GTGCAGGGCGCCGCGGCCGCCGG + Exonic
1168830107 20:841214-841236 GTTCACTTGCCCGCGGCCGCCGG + Intronic
1173820158 20:46014275-46014297 GTGAGCGCCGCCGCGGCCGCCGG + Intronic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
951640355 3:24829286-24829308 GCTCGCTGCGCCCCGCCCCCTGG - Intergenic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG + Intergenic
977065074 4:92304302-92304324 CATCGCTGCGCGGGGGCCGCGGG - Intergenic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987193256 5:15500403-15500425 GTGCGCGGCGCTGCGCCCGCCGG + Exonic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
993168411 5:84384765-84384787 GTTCTCCGCGCGGCGGCTGCGGG + Exonic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002929185 6:1621524-1621546 GTCCGCTTGGCCGCGGGCGCTGG - Intergenic
1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG + Exonic
1003926898 6:10884640-10884662 GTTCGCTGGTCCGCTGCCACTGG - Intronic
1006369174 6:33633734-33633756 TTTCGCTTCGCCGCGGGGGCGGG + Intronic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020418226 7:7969495-7969517 GTGGGCTGCGCCCCGGCTGCGGG + Exonic
1023016341 7:35971602-35971624 GTTCCCTGCGCCGCCGCCTTCGG + Intergenic
1024578305 7:50782393-50782415 GTGGGCTCCGCCGCGGGCGCTGG - Intronic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1028762337 7:94509914-94509936 GTCGGGGGCGCCGCGGCCGCGGG + Exonic
1033165573 7:139036034-139036056 GCTCGCTGCGCCGCGCGCACAGG - Intergenic
1034436030 7:151063158-151063180 GGCCGCTGCTCCGCGCCCGCAGG + Intronic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1045098946 8:98825892-98825914 CTTCTCTGGGCCGCCGCCGCAGG - Intronic
1045432135 8:102124112-102124134 GCTCGGTGCGCCGCGGGCGCAGG - Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1061038731 9:128127718-128127740 GTTCGCTCCGCCGGCGCCGCGGG + Exonic
1061859535 9:133460761-133460783 GCTCACTGCCCCGCGGCCCCAGG - Intronic
1061975928 9:134068053-134068075 ATGCGCTGCGCCGCGGCGCCTGG + Intronic
1062341509 9:136095583-136095605 GTCCTCTGCGCCGCGGCGTCCGG - Intergenic
1195702621 X:107716472-107716494 TTTCACGGCGCAGCGGCCGCAGG + Intronic
1198302402 X:135344867-135344889 GTTCCCTGGGGCGCGGGCGCGGG + Intronic