ID: 1119520192

View in Genome Browser
Species Human (GRCh38)
Location 14:75279253-75279275
Sequence CGGTGCCGGCTCGGGGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119520178_1119520192 12 Left 1119520178 14:75279218-75279240 CCCTTGTGCCTGGAGGGAGGCTG 0: 1
1: 0
2: 3
3: 29
4: 285
Right 1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG 0: 1
1: 0
2: 0
3: 19
4: 197
1119520181_1119520192 4 Left 1119520181 14:75279226-75279248 CCTGGAGGGAGGCTGCCGTGGCC 0: 1
1: 0
2: 6
3: 47
4: 407
Right 1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG 0: 1
1: 0
2: 0
3: 19
4: 197
1119520179_1119520192 11 Left 1119520179 14:75279219-75279241 CCTTGTGCCTGGAGGGAGGCTGC 0: 1
1: 0
2: 2
3: 56
4: 384
Right 1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG 0: 1
1: 0
2: 0
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119520192 Original CRISPR CGGTGCCGGCTCGGGGGCTC GGG Intronic
901641223 1:10694160-10694182 CGGCCCCGGCTTGGGGGCCCTGG + Intronic
903652269 1:24929540-24929562 GGGCGCCGGCCCTGGGGCTCCGG - Intronic
914666997 1:149840478-149840500 GGGCGCCGGCTCGCGGGCTTTGG - Exonic
914668770 1:149853312-149853334 GGGCGCCGGCTCGCGGGCTTTGG + Exonic
919823785 1:201489588-201489610 CGGAGCCAGATCAGGGGCTCAGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922460241 1:225810148-225810170 CGGTCTCGGCTCGCAGGCTCCGG - Intronic
922809220 1:228406654-228406676 CGGCGCAGGCTCGGGCACTCCGG + Exonic
1062843892 10:690015-690037 CGGGGGCGGGTTGGGGGCTCGGG + Intergenic
1065963107 10:30750271-30750293 AGGTGGGGGCTCTGGGGCTCTGG - Intergenic
1066758208 10:38730880-38730902 CGGCGCAGCCTCGGAGGCTCAGG + Intergenic
1067071933 10:43138627-43138649 CGGTGCGGGCGCCGGGGCTGCGG + Intronic
1068845161 10:61663230-61663252 CGGGGCCGGCTGGGGGGCGCCGG - Intronic
1069995932 10:72342221-72342243 CCGTCCCGGCTAGGGGGCCCTGG - Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1073481327 10:103787843-103787865 CAGTGCTGGCTGAGGGGCTCGGG - Intronic
1074591927 10:114821886-114821908 CGCGGGCGGCTCGGCGGCTCCGG - Exonic
1075769027 10:124917461-124917483 CGGGGACGGCCCGGGGGCTGTGG + Intergenic
1077106033 11:843048-843070 GGGGTCCGGCGCGGGGGCTCGGG + Intronic
1077485148 11:2835074-2835096 GGGTGCAGGCCCGGGGGCTGGGG + Intronic
1080064320 11:27992689-27992711 TGGTGCCAGCACGGTGGCTCAGG + Intergenic
1081636772 11:44727043-44727065 CGGGGCCGGGGCTGGGGCTCGGG - Intronic
1082025083 11:47565705-47565727 AGGTGCCGGGTCGGGCGCACCGG + Exonic
1083592434 11:63903562-63903584 CGGTGAAGGCTGGGGAGCTCTGG - Intronic
1083669402 11:64291793-64291815 CGGTGCGGGCTCCGGTGCGCGGG + Intronic
1084146148 11:67266415-67266437 CGGCGGCGGCTCCGGGGCGCGGG + Exonic
1084650602 11:70487093-70487115 CGCAGCTGGCTCGGTGGCTCCGG + Intronic
1084973092 11:72781828-72781850 GGCTGGGGGCTCGGGGGCTCGGG + Intronic
1089556229 11:119317182-119317204 CGGGGCGGGCCCGGGCGCTCCGG - Intronic
1090499113 11:127244328-127244350 CCGTTCCAGCTGGGGGGCTCAGG - Intergenic
1092256150 12:6927849-6927871 CCGCGCCGGGTCGGGGCCTCGGG + Intronic
1092526396 12:9312618-9312640 GGGTGCCTGGCCGGGGGCTCTGG - Intergenic
1094512167 12:31103318-31103340 GGGTGCCTGGCCGGGGGCTCTGG - Exonic
1095643343 12:44510860-44510882 AGGTGCCGGCTCAGAGGCACAGG + Intronic
1096102543 12:48978475-48978497 CGGTCCCGGCTGGTGGGCTGAGG - Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1100992775 12:100267712-100267734 CCATGCCGGCTCGAGAGCTCGGG + Exonic
1104643510 12:130481918-130481940 TGGTGGCGGCTTGGGGGGTCGGG - Intronic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1105701944 13:22940566-22940588 GGGTGAAGGCTTGGGGGCTCTGG - Intergenic
1105854569 13:24362372-24362394 GGGTGAAGGCTTGGGGGCTCTGG - Intergenic
1106075567 13:26458034-26458056 CGGAGCGGGGGCGGGGGCTCAGG - Intergenic
1106304090 13:28495031-28495053 CGGAGCGGGCTCCGGGGCTCGGG - Exonic
1107595716 13:41961033-41961055 CGGGGACGGCGAGGGGGCTCGGG + Exonic
1110436418 13:75481945-75481967 CGGGCGCGGCTCGGAGGCTCCGG + Exonic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1117377382 14:55129101-55129123 CGGCGGCGGCTCGGGGTGTCTGG + Exonic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1121127608 14:91417965-91417987 CGGTGCCAGCCCGGGAGCCCGGG + Intergenic
1122517206 14:102317340-102317362 AGGTGGCGGCGCGGGGACTCGGG - Intergenic
1122830563 14:104393633-104393655 TGGTGCCGGCTGGGGAGCCCTGG - Intergenic
1122880792 14:104689670-104689692 CGGGGCCGGGTCAGGGGCTGCGG - Exonic
1122917516 14:104865760-104865782 CGGTGCCGGGGCGGGGACCCGGG - Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1123110315 14:105864095-105864117 CGGAGCAGCCTGGGGGGCTCAGG - Intergenic
1125689620 15:41585526-41585548 CGGTGGCGGCCCGTGGGCGCGGG + Intergenic
1126777548 15:52112604-52112626 TGGCGCCGGCTCGGGGGTGCCGG + Exonic
1128153550 15:65377868-65377890 CGGGGCCGGGGCTGGGGCTCCGG + Exonic
1128264013 15:66252576-66252598 CCGCCCGGGCTCGGGGGCTCTGG + Intronic
1128335447 15:66782925-66782947 TGGTTCTGGCTCGGGGTCTCTGG + Intergenic
1129675934 15:77632506-77632528 CGGAGCCGGGGCCGGGGCTCGGG + Intronic
1131048879 15:89333680-89333702 CGGTTCCAGCTCCGGGGCGCTGG - Exonic
1131231938 15:90665763-90665785 CGGTGCCGCCTCAGGCGCTGTGG - Intergenic
1132153187 15:99476573-99476595 CTGTGCAGGCTCCGGGGCTCCGG + Intergenic
1132711236 16:1268905-1268927 CGGAGCCGGCTCTGGGGTTGGGG + Intergenic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1134438865 16:14285743-14285765 CCCGGCGGGCTCGGGGGCTCGGG - Intergenic
1136242116 16:28951056-28951078 CGGTGCCGGCCGAGGGGGTCGGG + Exonic
1138179239 16:54931061-54931083 TGGCCCCGGCTCCGGGGCTCCGG - Exonic
1138660956 16:58516494-58516516 CGGTGCCTGCTCCAGGGCACAGG + Exonic
1141538644 16:84700460-84700482 GGGAGGCGGCCCGGGGGCTCCGG + Intronic
1141989594 16:87602505-87602527 CGGGCCCGGCTCGCGCGCTCGGG - Intronic
1142151532 16:88514598-88514620 AGATGCCAGCTCCGGGGCTCTGG + Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1143447651 17:7018633-7018655 GGGGGCCGGCTCGGGTCCTCAGG - Intergenic
1143708621 17:8718169-8718191 CGGTGGCGGCGGGGAGGCTCAGG + Intergenic
1144500839 17:15786216-15786238 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1144760330 17:17703526-17703548 TGGCTCCGGCTCTGGGGCTCAGG + Intronic
1144764230 17:17724217-17724239 CGGCGGCGGGCCGGGGGCTCGGG - Intronic
1145110357 17:20156460-20156482 CGGTGCCTGCCCGGCGGCCCCGG - Intronic
1145163000 17:20588878-20588900 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1145970082 17:28951204-28951226 GGGTCCCGGCTCCGGGGGTCAGG + Exonic
1146438909 17:32876872-32876894 TGGCGCCAGCGCGGGGGCTCAGG + Exonic
1146787410 17:35731917-35731939 CGGGGCCGGGTCAGGGGCTCGGG + Intronic
1147123871 17:38352420-38352442 AGTTGGCGGCTCTGGGGCTCGGG + Exonic
1147996703 17:44363596-44363618 CCCTGCGGGCTGGGGGGCTCCGG + Exonic
1148048719 17:44759087-44759109 CGGAGCCGGGGCGGGGGCGCGGG - Exonic
1148186752 17:45649983-45650005 CAGTGCAGGCTCTGGGCCTCTGG - Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150778605 17:68101476-68101498 CGGTGCCCGCTCCGGGCATCTGG + Intergenic
1151812554 17:76453034-76453056 CGGCGCCGGGACGGGGGCTGCGG + Exonic
1151815319 17:76468807-76468829 CGCTGACAGCTCGGGGACTCGGG - Exonic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152335908 17:79700207-79700229 CGCTGCCTGCTGGGGGGCCCTGG - Intergenic
1152392114 17:80009337-80009359 CTGTGCTGGCTCTGGGGCTCCGG + Intronic
1152468361 17:80477713-80477735 CGGCGCCGGGCTGGGGGCTCAGG + Intronic
1152554001 17:81044093-81044115 AGGTGCCAGCCCGGGGGCTGTGG - Intronic
1152581153 17:81166129-81166151 CGGTGCGGGCTCTGCGGCTGCGG - Intergenic
1152843922 17:82587745-82587767 CGGTGTCGGCGCGGAGGTTCTGG - Intronic
1154044919 18:10895516-10895538 CTGTTCCAGCTGGGGGGCTCTGG - Intronic
1155942277 18:31811314-31811336 CGGTGCCGGCGCGGGTCCTCCGG + Intergenic
1159256473 18:65953770-65953792 CGGTCCAGGCGCGGTGGCTCAGG - Intergenic
1160008577 18:75087405-75087427 GGGCGCCAGCTCGGAGGCTCTGG - Intergenic
1160700886 19:506795-506817 AGGTGCCAGCCCGGGGGCCCTGG + Intergenic
1160718733 19:588553-588575 CGGGGCCGGCGTGGGGGCGCAGG + Intergenic
1160769438 19:823693-823715 CGGTTCCTGCAGGGGGGCTCGGG + Intergenic
1160814467 19:1028752-1028774 CTCTGCCGGCTCAGGGGCCCAGG - Intronic
1161364168 19:3868752-3868774 GGATGCGGGCTCCGGGGCTCCGG - Intronic
1161478722 19:4500071-4500093 CGGTGGAGGCTCGGGGGCGGAGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162754943 19:12852246-12852268 AGGTGCCGGCTGGTGGGCGCAGG + Exonic
1162861126 19:13506381-13506403 CGGCGGCGGCTCGGCGCCTCGGG + Intronic
1162914265 19:13865707-13865729 CGGCCCCGGCTCCGGGACTCGGG - Intronic
1164429211 19:28172283-28172305 CTGTGTTGGCTCGGGGTCTCAGG + Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165225068 19:34349028-34349050 CGGTGGCTGGTCGGGTGCTCAGG + Exonic
1166096562 19:40542927-40542949 AGGTGCTGGCTCGGGGTCTGAGG + Intronic
1166851096 19:45761709-45761731 CGGTGCAGGCTGTGGGACTCAGG - Exonic
1167405034 19:49301194-49301216 CAGTGCTGGCTCGGGGGATGGGG - Intronic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
926267990 2:11344083-11344105 CGGCGCGGTCTCGGGGGCGCCGG + Exonic
927215772 2:20667192-20667214 CGGCGCGGGCTCCGTGGCTCCGG - Exonic
928511625 2:32009608-32009630 GGCTGCGGGCGCGGGGGCTCGGG + Intronic
929610707 2:43268838-43268860 CAGTGCTGGCTGGGGTGCTCAGG + Intronic
929857868 2:45651323-45651345 CCGATCCGGCTCGGGGGCGCAGG - Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
933886221 2:86720850-86720872 CGGGGCCGGGACCGGGGCTCGGG - Intronic
933923959 2:87075856-87075878 CGGGGCCGGGACCGGGGCTCGGG + Intergenic
934736296 2:96691511-96691533 CGGAACCGGCTCTGGGGCTGAGG - Intergenic
936234659 2:110732658-110732680 CGGCGCCGGGTCTGGGGCTCGGG + Exonic
936278885 2:111121503-111121525 CGGCGCCGGCCCGGGAGCTGAGG + Intronic
936531148 2:113277860-113277882 CGCTGCCGGCTCCCGGGCCCGGG + Intronic
938117570 2:128612324-128612346 AGATGCCAGCTCTGGGGCTCAGG - Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
940954480 2:159712640-159712662 CGGTGCCGGCTCAGGAGCCGGGG + Intronic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
944154113 2:196593144-196593166 CGGAGCCGCCTCGAGAGCTCTGG - Intronic
948523998 2:238559321-238559343 GGGTCCCGTCTTGGGGGCTCTGG - Intergenic
948906453 2:240981942-240981964 AGCTGCCAGCTCTGGGGCTCAGG + Intronic
949040075 2:241844025-241844047 CGCTGCAGGGTCGGGGGCGCGGG + Intergenic
1168972027 20:1937671-1937693 CGGTGCAGGCTCTGGGACCCAGG + Exonic
1169557805 20:6768407-6768429 CGGGGCCGGCTCCGGGACTCGGG - Exonic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1175985548 20:62762633-62762655 AGGGGCCGGCTCAGGGGCTCCGG - Exonic
1176023255 20:62973217-62973239 CGGTGCCAGCTCTGGTGGTCCGG + Intergenic
1176157314 20:63628053-63628075 GGGTGCCGGCTGCGGGACTCGGG - Intergenic
1176871225 21:14084495-14084517 CGCTGCGTGCTCCGGGGCTCCGG + Intergenic
1178914050 21:36697310-36697332 AGCTGCCGGCTCCGGGCCTCTGG - Intergenic
1180064531 21:45405709-45405731 CGGTCCCCGCGCGGGGACTCCGG - Intronic
1181007557 22:20021181-20021203 CGGCCTGGGCTCGGGGGCTCCGG + Intronic
1181314433 22:21962393-21962415 CGGAGCCGGCTCTGGGGCCTGGG + Intronic
1182470286 22:30544186-30544208 CGGTGCAGGCTCTGGGACCCAGG + Intronic
1183290966 22:37001941-37001963 CGGTCCCAGCTTGGGGGCTCAGG - Exonic
1183386658 22:37519137-37519159 CGGGGCCGGCTCGGGGTCTGAGG - Exonic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1184242888 22:43220726-43220748 CAGGGCTGGCTCGGGGTCTCAGG + Intronic
1184644829 22:45890051-45890073 CGGTACCGGCTCTGCGGCCCGGG + Intergenic
1185128081 22:49022778-49022800 CGGTGCAGGCTCTGGCCCTCAGG - Intergenic
1185409688 22:50675019-50675041 CGGAGCGGGCTCGTGAGCTCAGG - Intergenic
950543234 3:13624706-13624728 AGGTGGAGGCTTGGGGGCTCTGG - Intronic
952442175 3:33341860-33341882 AGGTGAAGGCTCTGGGGCTCTGG + Intronic
954076833 3:48187913-48187935 CGGCGGCGGTGCGGGGGCTCCGG + Exonic
954613015 3:51956140-51956162 CGGTCCTGGCTGGGGGCCTCGGG + Exonic
961305737 3:125958447-125958469 CGTTGCCGGATGAGGGGCTCTGG - Intergenic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
968377229 4:53640-53662 CGGTCCCCGCACGGCGGCTCTGG + Intronic
968514871 4:1011766-1011788 GGGTCCGGGCTCGGGCGCTCGGG - Intronic
968674845 4:1871698-1871720 AGGGGCCGGCTCAGGGGCTGGGG + Intronic
969240383 4:5893128-5893150 CGGGGCCGGGGCGGGGCCTCTGG + Intergenic
969405222 4:6987144-6987166 CGCTGCCGGCTCGGCGCGTCAGG - Intronic
971635136 4:29047790-29047812 GGGCGGCGGCTGGGGGGCTCAGG - Intergenic
972437246 4:39045335-39045357 GGGCGCCGGCTCCGGCGCTCGGG - Intronic
985657017 5:1137558-1137580 CAGTGCCTGCTCGGGGGGTCTGG - Intergenic
987050491 5:14143815-14143837 CGGTGCCGGCGAGGGGGCAGAGG + Exonic
1006642867 6:35497526-35497548 CGGAGCCGGGTCTGGGGCCCCGG - Intergenic
1007363233 6:41373249-41373271 GGGAGCCGGCGCGGCGGCTCGGG - Intergenic
1013836723 6:114342887-114342909 AGCTGCCGGCTCGGGCGCTCTGG - Exonic
1019409940 7:901956-901978 TGGAGCCGACTCTGGGGCTCCGG + Intronic
1022094557 7:27130576-27130598 AGGTGCTGGGTCGGGGGCGCTGG + Exonic
1022504094 7:30899886-30899908 AGGTGCTGGCTCGGGGCCTGAGG + Intergenic
1022550682 7:31236477-31236499 GGGTGCCGGCTCAGGGAGTCAGG + Intergenic
1028935147 7:96456017-96456039 TGGTGCCGTATCGAGGGCTCAGG - Intergenic
1029570208 7:101363648-101363670 CGGGTCCGGCTCCGGGGCTGCGG + Intronic
1032090685 7:128910197-128910219 CGGTGCCGGCACGGGGCCAGGGG - Intronic
1034941953 7:155236505-155236527 CGGTGCTGGGCCGGGGACTCTGG - Intergenic
1035020411 7:155797249-155797271 GGGAGCCGGGTCGGGGGCTGGGG - Intergenic
1035222337 7:157413620-157413642 GGGCACCGGCTCGCGGGCTCTGG - Intronic
1038319533 8:26514310-26514332 CGGCCATGGCTCGGGGGCTCGGG - Intronic
1038554131 8:28494575-28494597 CGGTGGCGGCTGGGGGCCTCGGG + Intronic
1039903275 8:41767699-41767721 AGGTGCCGGCCGGCGGGCTCGGG + Intronic
1042155584 8:65841577-65841599 GGGCCGCGGCTCGGGGGCTCCGG + Exonic
1044857798 8:96494130-96494152 CGGCTCAGGCTCGGGGACTCGGG - Exonic
1045211661 8:100106009-100106031 CGGCGACGGCGCGCGGGCTCCGG + Exonic
1045516329 8:102863732-102863754 GGGGGGCGGCTGGGGGGCTCCGG - Intronic
1049396028 8:142401249-142401271 CGGTGCTGGGTGGGGTGCTCAGG + Intronic
1049758559 8:144321593-144321615 AGGTGCAGGCTCTGGGGGTCCGG - Intronic
1052142520 9:25004395-25004417 CAGTGCAGCCTCGGGTGCTCTGG - Intergenic
1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG + Intergenic
1055945452 9:81688431-81688453 CGGTGCGGGCTCCGGCCCTCAGG + Exonic
1057168569 9:92947343-92947365 GGGCGCCGGCTCGGGTGCACAGG - Intergenic
1057547971 9:96032169-96032191 GGGTGCTGGCTTTGGGGCTCAGG - Intergenic
1057739462 9:97699026-97699048 CTGTACAGGCACGGGGGCTCTGG + Intergenic
1058866600 9:109167018-109167040 CGGTGCGGGCCCGGGGGGCCGGG - Exonic
1059457145 9:114406691-114406713 CGGTGCCCGCTGGCGGGCTGCGG + Exonic
1062045536 9:134422821-134422843 CGGTGGAGGTTTGGGGGCTCTGG + Intronic
1062349745 9:136133054-136133076 CGGGGCAGGCTCTGGGGCGCGGG - Intergenic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic
1062575431 9:137205076-137205098 CGGAGCAGACTCGGGAGCTCTGG - Exonic
1062732882 9:138119460-138119482 CAGGGCTGGCACGGGGGCTCCGG - Intronic
1203572007 Un_KI270744v1:140606-140628 CGGTCCCCGCACGGCGGCTCTGG - Intergenic
1189323015 X:40097544-40097566 CGGGGCGGGCTCGGGGCCTCCGG + Intronic
1191830285 X:65407866-65407888 CGGTGCGGGCTCCGGCCCTCAGG - Intronic
1197873547 X:131082386-131082408 CGGTGCGGGCGCGGGGGCGGCGG + Intronic
1201416493 Y:13752927-13752949 CGGGGCCTGCGCGGAGGCTCTGG + Intergenic