ID: 1119520906

View in Genome Browser
Species Human (GRCh38)
Location 14:75284420-75284442
Sequence CTGTGCAATAAGCTAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119520906_1119520908 -7 Left 1119520906 14:75284420-75284442 CCTTGCTCTAGCTTATTGCACAG No data
Right 1119520908 14:75284436-75284458 TGCACAGCCCAGTGGAGACCAGG No data
1119520906_1119520913 19 Left 1119520906 14:75284420-75284442 CCTTGCTCTAGCTTATTGCACAG No data
Right 1119520913 14:75284462-75284484 CTACATCAAGATGGCGTTAAAGG No data
1119520906_1119520911 10 Left 1119520906 14:75284420-75284442 CCTTGCTCTAGCTTATTGCACAG No data
Right 1119520911 14:75284453-75284475 ACCAGGCTGCTACATCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119520906 Original CRISPR CTGTGCAATAAGCTAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr