ID: 1119522484

View in Genome Browser
Species Human (GRCh38)
Location 14:75296162-75296184
Sequence CTGCAGGACGGGAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 314}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119522484_1119522491 -4 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522491 14:75296181-75296203 GCAGCCGCCTGATTTGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1119522484_1119522495 2 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522495 14:75296187-75296209 GCCTGATTTGAGGAAGGGGCTGG 0: 1
1: 0
2: 5
3: 29
4: 279
1119522484_1119522498 24 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522498 14:75296209-75296231 GGATCCTTCCCCTTGCCCTCTGG 0: 1
1: 0
2: 0
3: 23
4: 228
1119522484_1119522497 3 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522497 14:75296188-75296210 CCTGATTTGAGGAAGGGGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 271
1119522484_1119522493 -2 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522493 14:75296183-75296205 AGCCGCCTGATTTGAGGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1119522484_1119522492 -3 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522492 14:75296182-75296204 CAGCCGCCTGATTTGAGGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 102
1119522484_1119522489 -8 Left 1119522484 14:75296162-75296184 CCAACTGCCCTCCCGTCCTGCAG 0: 1
1: 0
2: 3
3: 28
4: 314
Right 1119522489 14:75296177-75296199 TCCTGCAGCCGCCTGATTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119522484 Original CRISPR CTGCAGGACGGGAGGGCAGT TGG (reversed) Intergenic
900102415 1:967502-967524 CTGCCTGACGGGGGTGCAGTGGG - Intronic
900527044 1:3134470-3134492 GTGCGGGAGGGGAGGGCAGGAGG - Intronic
900577188 1:3389242-3389264 CTGCGAGGCGGCAGGGCAGTGGG - Intronic
901632894 1:10656558-10656580 CGGCAGGCGGGGACGGCAGTGGG - Intronic
901648508 1:10729203-10729225 CTGCAGGGCGGGAGGCCAGAGGG + Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
902187736 1:14738057-14738079 GTGCTGGACTGAAGGGCAGTAGG - Intronic
902778210 1:18687988-18688010 CTGAAGCATGGGAGGGCACTGGG + Intronic
903021903 1:20400634-20400656 CTGCAGGCTGTGTGGGCAGTTGG - Intergenic
904320985 1:29697691-29697713 CTGCAGGAGGGGAGGTGAGGTGG + Intergenic
904404558 1:30277510-30277532 ATGCTGGAAGGGAGGGCAGAAGG - Intergenic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
905289858 1:36913838-36913860 CTGCAGGATGGGTGGGCTGAAGG - Intronic
905824380 1:41017606-41017628 CTGCAGGACAGGAGGGCCTCTGG - Intronic
906210215 1:44008624-44008646 CTGCAGGAGGGGAGGGGTGGGGG + Intronic
907048278 1:51313302-51313324 CTGCAGGAGGTGGGGGCAGAAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907474684 1:54697948-54697970 CTGCAGGGCGGAAGGGCTGCTGG - Intronic
907702972 1:56807138-56807160 CTGCAGCAGGAGAGGGCAGCAGG - Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
911261671 1:95693789-95693811 CAGCAGGTGGTGAGGGCAGTGGG + Intergenic
911982799 1:104586921-104586943 CTGCAGGAAGGGGCGGCTGTGGG + Intergenic
915479508 1:156175349-156175371 CTGCAGGATGGGAGGACTCTTGG - Intronic
915510630 1:156385082-156385104 GTGCAGGCTGGTAGGGCAGTCGG - Exonic
916288353 1:163135765-163135787 TTGGAGGAAGGGAGGGCATTAGG - Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
920534541 1:206729126-206729148 GTGCAGGCAGGCAGGGCAGTGGG + Intronic
922237491 1:223733102-223733124 CTGCAGGACAGGAGGTGTGTGGG - Intronic
922795304 1:228336813-228336835 CGGCAGGGCAGGAGGCCAGTGGG - Intronic
1062832285 10:613930-613952 CTGGAGGAAGGCAGGGCAGATGG - Intronic
1063353109 10:5374213-5374235 AGGCTGGACGGGAGGGCAGCGGG + Exonic
1063427806 10:5963359-5963381 CTCCAGGATGGGAGGCCAGCAGG - Intronic
1063862610 10:10327991-10328013 CTGCAGGATGGAAGGATAGTGGG - Intergenic
1065495340 10:26321775-26321797 CTGCAGAAAGGAAGGGCAGTGGG + Intergenic
1066048959 10:31618179-31618201 CTGCAGGAAGGGTGGGAGGTGGG - Intergenic
1066129510 10:32378840-32378862 CTGCAGGAGGCGGGGGCAGCGGG - Intergenic
1066502524 10:36007928-36007950 CTGCAGGAGCAGTGGGCAGTGGG + Intergenic
1067063228 10:43088947-43088969 CGGCAGGACGGGAGGGCTGGGGG - Intronic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1069175226 10:65281931-65281953 CTGCAGGGTGAGAGAGCAGTGGG + Intergenic
1069878198 10:71576019-71576041 CTCCAGGACAGGAGGACAATGGG - Intronic
1070302023 10:75210671-75210693 CTGCAGGACCGGGGCGCTGTCGG + Intronic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1073442324 10:103559437-103559459 CTGCTGGACGGCAGGGCAGTTGG + Intronic
1073734016 10:106325752-106325774 GTGCAGGAAGGGAGAGCATTAGG - Intergenic
1075701220 10:124470417-124470439 CTACTGGACGGAAGGGCTGTGGG - Intronic
1076483873 10:130803110-130803132 CTGCTGGTGGGGTGGGCAGTGGG + Intergenic
1076614193 10:131745295-131745317 CTGCAGGACGGAAGCACAGGAGG + Intergenic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077104156 11:834740-834762 CTGCAGGTCGGGCGGGCACGGGG + Intronic
1077142737 11:1031550-1031572 CCGCAGCACGGGGGGGCAGGTGG - Intronic
1077198888 11:1295679-1295701 CTGCAGTACGGAGGCGCAGTGGG - Exonic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1079660912 11:23035563-23035585 CAGCAGGACGGAAGGGGAGGTGG - Intergenic
1080954010 11:37071480-37071502 ATGCGGGATGGGAGTGCAGTGGG - Intergenic
1081363240 11:42205339-42205361 CTGCAGGTTGTGAAGGCAGTGGG - Intergenic
1081540490 11:44031239-44031261 CTGCTGGAAGGGATGGCAGGGGG - Intergenic
1081615660 11:44589611-44589633 CTTTAGGACGGGAGTCCAGTTGG + Intronic
1082872090 11:57953133-57953155 CTGCAGGAAGGGGTGGCTGTGGG - Intergenic
1083187339 11:61025413-61025435 CTGGAGGAAGGGAGGCCAGCTGG + Intergenic
1083835259 11:65262378-65262400 CTGCAGGGCGGGAGGGGTGCGGG - Intronic
1084273365 11:68040334-68040356 CTGCAGGTGGGCAGGGCAGGGGG - Intronic
1084457614 11:69277607-69277629 ATGCAGGGCAGGTGGGCAGTAGG + Intergenic
1084574081 11:69977508-69977530 CTGCAGGCTGGGAGGGCTGGGGG - Intergenic
1084586454 11:70065507-70065529 CTTCAGGCCAGGAGGGCACTGGG - Intergenic
1084715374 11:70870253-70870275 CTGCAGGAGGGGACGGCTCTGGG - Intronic
1084858978 11:72005892-72005914 CTGCAGGAAGGAGGGGCAGGTGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1087430466 11:98047019-98047041 CTGCAGCACTCTAGGGCAGTTGG - Intergenic
1088865138 11:113840178-113840200 CTACAGGATTGGTGGGCAGTTGG - Intronic
1090246797 11:125221886-125221908 CTACAGCCCGGGCGGGCAGTGGG - Intronic
1090354392 11:126130132-126130154 CTGCAGGAAGGGAGGCCACCTGG + Intergenic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091584883 12:1810438-1810460 CTGCAGGGAAGGAGGGCATTTGG + Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1092111459 12:5967741-5967763 TGGGAGGACGGGAAGGCAGTGGG - Intronic
1092155537 12:6279422-6279444 CTGCAGGCTGGGTGGGTAGTTGG - Intergenic
1097137533 12:56871310-56871332 CTTCAGGATGGGAGGTGAGTAGG - Intergenic
1098061972 12:66572592-66572614 CTGAAGGAGGAGGGGGCAGTTGG + Intronic
1099243970 12:80172518-80172540 CTGCAGGTCAGGAGGGCAATGGG + Intergenic
1099957849 12:89368643-89368665 CATCAGGTGGGGAGGGCAGTGGG + Intergenic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1104076106 12:125391553-125391575 CTGCAGGTCTGCAGGGGAGTAGG - Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1104984142 12:132587197-132587219 CTGGAGGACGGCAGTGCAGCTGG + Intergenic
1105578147 13:21671813-21671835 CTGCAGTAAGGGAGGGGAGTTGG + Exonic
1106578907 13:31000840-31000862 CTGCAGCAAGGCAGGACAGTGGG - Intergenic
1108663363 13:52605990-52606012 CTGCAGGCCAGGACTGCAGTGGG - Intergenic
1111119118 13:83823469-83823491 CTGCAGCAGGGGAGTGCAGCTGG + Intergenic
1112296873 13:98195573-98195595 CACAAGGAAGGGAGGGCAGTGGG + Intronic
1115688903 14:35824689-35824711 CTCCCGGACGGGAGGGAGGTGGG - Intergenic
1115853594 14:37606374-37606396 GTGCAGGACTGAAGGGCAGGAGG + Intronic
1115906503 14:38208691-38208713 CTGCGGGACGGGAGAGAAGCTGG + Intronic
1118748467 14:68790425-68790447 CTGCTGGACAGAAAGGCAGTGGG - Exonic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1121101018 14:91250368-91250390 CTGCAGGCAGTGGGGGCAGTAGG - Intronic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1122159837 14:99774786-99774808 CTGAAGGAAGGAAGGGCAGAAGG + Intronic
1122635831 14:103129214-103129236 CTGCAGGGCTGGAGCGCAGTGGG + Intronic
1122809315 14:104280246-104280268 CTGCAGGCCGGGAGGCAAGGAGG + Intergenic
1125721377 15:41846753-41846775 CTGCAGGAGGGGCAGGCAGCTGG - Exonic
1126527440 15:49672254-49672276 CCACAGTAGGGGAGGGCAGTAGG + Intergenic
1128111061 15:65076632-65076654 CTGCAGGCCCGGAGGGCATCTGG - Intronic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1131400779 15:92124042-92124064 CTGCAGGAGGGGCTGGCAGTGGG + Intronic
1131459401 15:92607715-92607737 CAGCAGGTCGGGAGGACAGCAGG - Intergenic
1131754849 15:95548703-95548725 CTGCAGGAGAGGTGGGCACTTGG - Intergenic
1132535537 16:477612-477634 CTGCAGGACGGCAGGGCCCAGGG - Intronic
1132735862 16:1385555-1385577 CACCAGGACGGCAGGGCAGCGGG + Intronic
1132777666 16:1604720-1604742 CTGGAGGAGGGAAGGGCGGTTGG + Intronic
1133282849 16:4676968-4676990 CTGCAGGACAGGATGGCAGGCGG - Intronic
1135411254 16:22236296-22236318 CTGCAGGAGGGGAGAGTAGTTGG + Intronic
1135983117 16:27164018-27164040 CTGCAGCAGGGAAGGGAAGTAGG + Intergenic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1137270115 16:46897762-46897784 CTGCAGGAGGGCAGGGCCCTGGG + Intronic
1138365967 16:56477437-56477459 TTGCAGGATGGAAAGGCAGTGGG - Exonic
1138430531 16:56965777-56965799 CTGCAGGCAGGGAGGCCAGTGGG - Intronic
1139528138 16:67528941-67528963 CTGCAGGCCGGGCGGGGAGCAGG + Intronic
1139661773 16:68425706-68425728 CTGCAGGCTGGGAGGGTGGTGGG + Intronic
1139922885 16:70470852-70470874 CTGCAGGGCAGGGGAGCAGTAGG + Intronic
1141172433 16:81699891-81699913 CTGCAGGCACGGGGGGCAGTGGG + Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1143858299 17:9869200-9869222 CTGGAGGAGGGGAGATCAGTTGG - Intronic
1143929231 17:10403774-10403796 GTGCAGGAAGGAGGGGCAGTTGG - Intronic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1147253395 17:39166742-39166764 CTGCAGGAAGGCAGTACAGTCGG - Intronic
1147311267 17:39597287-39597309 GGGGAGGACGGGAGGGGAGTAGG + Intergenic
1147316103 17:39621205-39621227 CCTCAGGACGGGTGGGCACTGGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1151816423 17:76473595-76473617 CCGCAGCTCGGGGGGGCAGTGGG + Intronic
1152626052 17:81388441-81388463 CTCCAGGGCTGGAGGGCAGGTGG + Intergenic
1152756891 17:82090730-82090752 GGGCAGGACGGGAGGGGAGGAGG - Intronic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1157385116 18:47253821-47253843 CTGTAGGGTGGGAGGGCACTGGG - Intergenic
1158547191 18:58406329-58406351 CTTCAGGATGTGTGGGCAGTAGG - Intergenic
1158932665 18:62336366-62336388 GTGAAGGAAGGGAGGGCAGCAGG + Intronic
1159609492 18:70510104-70510126 CTGCAGGATGGGTGGGTAGAAGG + Intergenic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1163282227 19:16324990-16325012 CTGCAGGAGGTGAGGGCGGCGGG + Exonic
1163567186 19:18058683-18058705 CTGCAGAACGCGAGGGAGGTGGG + Intergenic
1163669692 19:18620385-18620407 CTGCAGGAAGAGAGGGGAGGAGG - Intronic
1165700532 19:37933737-37933759 TTGCAGGACAGGAAGGCAGAGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166420452 19:42632329-42632351 GAGCAGGACCTGAGGGCAGTGGG - Intronic
1166423334 19:42654897-42654919 GAGCAGGACCTGAGGGCAGTGGG + Intronic
1167672117 19:50859370-50859392 CTGCAGGGAGGGAGGGCAGCAGG + Intronic
1167674870 19:50877796-50877818 CTGCAGGGAGGGAGGGCGGCAGG + Intronic
1167852497 19:52212852-52212874 CAGAAGGACGGGAGAGCAGAGGG - Intronic
925025121 2:601458-601480 CTACAGGACGAGGGGGCAGCCGG + Intergenic
925185878 2:1846089-1846111 CTCCAGGTCGGGATGGCACTAGG - Intronic
925337490 2:3108841-3108863 CTGGAGAAGGCGAGGGCAGTGGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
927083027 2:19649104-19649126 CTGCAGGAGGAGGGGGCATTTGG - Intergenic
927181370 2:20448504-20448526 CTGCGGGAGGGGAGGGCTGCTGG + Exonic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928434864 2:31248461-31248483 GTGCAGGACAGGAGGCCAGGAGG - Intronic
931643920 2:64404586-64404608 CTCCAGGACAGCAGGGCAGAGGG - Intergenic
932734245 2:74243237-74243259 CTGCAGAACGGGGGAGCAGAAGG - Intronic
934519716 2:95012331-95012353 CTGCAGGACTGGAGACCAGCAGG - Intergenic
935046882 2:99490322-99490344 GAGCAGGACGGGCGGGCAGGCGG - Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937952961 2:127402351-127402373 CTGCAGGATGGGAGGGCCCAAGG - Intergenic
941703122 2:168626881-168626903 CTGCAGGAGGGGAGGAATGTTGG - Intronic
942064057 2:172253624-172253646 TGGCAGGAGGGGAGAGCAGTTGG + Intergenic
942243208 2:173983128-173983150 ATGCAGCACGGAAGGGGAGTGGG + Intergenic
944292085 2:198018776-198018798 CTGCAGGAAGGGGCGGCTGTAGG + Intronic
944863752 2:203840477-203840499 ATGCATGAGGGGAGGGCTGTGGG + Intergenic
946189817 2:218002292-218002314 GTGGAGGAAGGGATGGCAGTGGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
948273032 2:236688378-236688400 CTGCAGGATGGGAGGGCCAGGGG + Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948614080 2:239187161-239187183 CTGCAGGAAGGCAGGGAAGCCGG + Intronic
948676318 2:239598936-239598958 ATGCAGGAGGGCAGGACAGTGGG + Intergenic
1170907522 20:20529088-20529110 AGGCAGGAGAGGAGGGCAGTGGG + Intronic
1171177259 20:23061715-23061737 CTGCAGGAAAGAAGGGCAGTGGG + Intergenic
1171392255 20:24809161-24809183 CTGCAGGGCTGCAGGGCAATGGG + Intergenic
1172115933 20:32573726-32573748 CTGCAGGTCAGCAGAGCAGTGGG - Intronic
1172407426 20:34700084-34700106 CTGCAGGACTGGAGGTCAAGAGG - Intronic
1175243607 20:57567837-57567859 GTGCAGGAGGGGAGGGAATTTGG - Exonic
1175336248 20:58198229-58198251 CTGCAGGATGGGCGGGGAGGGGG + Intergenic
1175542048 20:59754146-59754168 CTGCAGGATGGCAGGGCCCTCGG - Intronic
1175852287 20:62100069-62100091 CAGCAGGACAGCAGGGCCGTGGG - Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176239300 20:64068534-64068556 ATGCAGGGCAGGAGGGGAGTTGG - Intronic
1178701034 21:34834370-34834392 GTGCAGGAGAGGCGGGCAGTGGG + Intronic
1178884505 21:36474851-36474873 CTCCAGAACGGGAGGGGAGGCGG + Intronic
1179961384 21:44768711-44768733 CTGCAGGAGGGAAGCGCAGTCGG + Exonic
1180078725 21:45476328-45476350 CTGGAGGACGAGAGGGGAGGTGG - Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1182784687 22:32897497-32897519 CTGCAGGATGGGAGGCCGGCGGG - Intronic
1183080738 22:35454419-35454441 CTGCAGCAGGCGGGGGCAGTAGG + Intergenic
1183786014 22:40029667-40029689 CTGCAGGGCAGAAGGCCAGTTGG - Exonic
1184176620 22:42792765-42792787 CAGCAGGACGGCTGTGCAGTGGG + Intergenic
1184253749 22:43275677-43275699 CTCCAGGAAGGGAGGGGAATGGG + Intronic
1184281751 22:43441398-43441420 CAGGAGGAAGGGAGGCCAGTAGG - Intronic
1185140863 22:49100563-49100585 CTGTAACACGGGAGGGCACTGGG + Intergenic
950703590 3:14766727-14766749 CACCAGGCAGGGAGGGCAGTTGG + Intronic
953507247 3:43498344-43498366 TTGCAGGGGTGGAGGGCAGTTGG - Intronic
954143131 3:48620705-48620727 GTCCAGGACGGGCGGGCAGGTGG - Intergenic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954920573 3:54187482-54187504 CTGCAGGGCTGGAGGGTAATGGG + Intronic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
959656200 3:108807871-108807893 GTGAAGGATGGGAGGGCAGCGGG + Intergenic
959663212 3:108892294-108892316 CCGCAGAAGGGGATGGCAGTTGG + Intergenic
961566013 3:127763749-127763771 TTTGAGGACGGGAGGGCAGTAGG - Intronic
961582706 3:127895572-127895594 CTGCAGGAGGGGTGGGCGATGGG + Intergenic
962369042 3:134805535-134805557 CTGCTGGGCAGGAGGGCAGGAGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
964400189 3:156290599-156290621 CTCCAGGTCAGGTGGGCAGTAGG - Intronic
966855868 3:184193517-184193539 CTGAAAGACAGGAGGGCAGGAGG - Intronic
967877465 3:194276976-194276998 CTCCAAGACAGGAGGGCAGATGG - Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
968234671 3:197024484-197024506 CTCTAGGAGGGGAGGGGAGTGGG + Exonic
968902058 4:3436497-3436519 GGGCAGGAAGGGCGGGCAGTGGG + Intronic
969185401 4:5470667-5470689 CTGCAGCAAGGGAGGACTGTGGG - Intronic
969573609 4:8024242-8024264 GTGCAGGCTGGGAGGGGAGTCGG - Intronic
969652777 4:8477765-8477787 CTGCAGGACTGGGGGGCCGAGGG - Intronic
972351945 4:38244236-38244258 GTGGAGGAAGGGAGGGCAGGAGG - Intergenic
973047412 4:45551882-45551904 CTGGAGTACCGGAAGGCAGTTGG - Intergenic
973532045 4:51843947-51843969 CTGCGGGGCGGGAGGGGCGTTGG + Intronic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
977571394 4:98633008-98633030 CAGCAGGAAGCCAGGGCAGTTGG + Intronic
977910291 4:102526341-102526363 GTGAGGGATGGGAGGGCAGTGGG + Intronic
978710576 4:111775638-111775660 CTTCAGGAGGGGAGGGGAGGAGG + Intergenic
981110141 4:140925685-140925707 CTGCAGCATGGGAGGGCAGGTGG - Intronic
982198477 4:152937561-152937583 CCGCCGGACGGGAGAGCGGTCGG + Intronic
984717272 4:182937499-182937521 CTGCAGGACACGAGGGCAGGAGG - Intergenic
984936995 4:184898219-184898241 CAGCAGGACAGGAAGGCTGTGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985055265 4:186030574-186030596 CTGTAGGAGGGGAGGTCATTAGG - Intergenic
985070689 4:186164396-186164418 CTGCAGGCCGGGGGTCCAGTGGG - Intronic
985631876 5:1018078-1018100 CTGGAGGACGGGACGGTAGCAGG + Intronic
985730321 5:1543868-1543890 GTGCAGGAAGGGAGGGCAAAGGG - Intergenic
985777547 5:1852626-1852648 TAGAAGGACGGGAGGGCAGCAGG - Intergenic
985918349 5:2945719-2945741 CTGAAGGACGGGAAAGCAGTGGG + Intergenic
988913580 5:35870295-35870317 CTGCAAGGCAGGAAGGCAGTAGG + Intronic
992561624 5:77958104-77958126 CGGGCGGCCGGGAGGGCAGTTGG + Intergenic
993426664 5:87773594-87773616 CAGGAGGACGGGAAGGCAGCTGG - Intergenic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
995225131 5:109692297-109692319 CTGCTGGAGGGGAAGGCTGTTGG + Intronic
999174574 5:149623017-149623039 GTGCTGGAGGGGAGGGCTGTGGG - Intronic
999222797 5:149995413-149995435 CTGCAGGACAGCAGTACAGTTGG + Exonic
1000760871 5:165222841-165222863 TTGAAGGAAGGGAGTGCAGTTGG + Intergenic
1001413802 5:171529027-171529049 CTGCAGCACAGGAGAGCCGTGGG + Intergenic
1001635340 5:173206068-173206090 CTGCAGGATGAAAGGGCAGAGGG + Intergenic
1002095449 5:176828315-176828337 CTGCAGACCTGGGGGGCAGTGGG + Intronic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1003007084 6:2392203-2392225 ATGCAGGAAAGGAGGGCAGGAGG + Intergenic
1004447362 6:15712410-15712432 CTGCAGGAAGTGAGGGGAGCTGG - Intergenic
1005992745 6:30913781-30913803 CGGCAGGACGGGAGGGGCGCGGG - Intronic
1006164076 6:32054245-32054267 CTGGAGGCAGGGAGGCCAGTAGG - Intronic
1006801208 6:36760702-36760724 CAGGAGGACGGGAGTGCTGTGGG + Intronic
1006923890 6:37643748-37643770 CTGGAGGATGGGAGGGGAGTGGG - Intronic
1007702567 6:43773320-43773342 GTGCTGGGCGGGAGGGGAGTTGG + Intronic
1012223699 6:96681315-96681337 CAGCAGGAGGAAAGGGCAGTAGG + Intergenic
1012815507 6:104018067-104018089 ATGCAGCAAGGGAGGGCAGATGG + Intergenic
1012980978 6:105830818-105830840 CTGGAGGAGGGAAGGGCAGCTGG + Intergenic
1013896721 6:115097547-115097569 CTGCAGGACGTGAACGGAGTTGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016343403 6:143085820-143085842 CTTCAGGACAGGAGGACAGATGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017989195 6:159471377-159471399 CTGCAGCAGTGCAGGGCAGTGGG + Intergenic
1019194318 6:170272359-170272381 CTGGAGGACAGGGGGGCTGTCGG + Intergenic
1019401587 7:857143-857165 CTACAGGCGGGGAGGGCTGTGGG - Intronic
1019960870 7:4458342-4458364 CTGCGGGAGGGCAAGGCAGTAGG + Intergenic
1020587410 7:10086300-10086322 CTTCAGGAAGGAAGGGCAGTGGG - Intergenic
1021852392 7:24821431-24821453 GGGGAGGAAGGGAGGGCAGTGGG + Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022815855 7:33913515-33913537 CTGGAGTAGGGGTGGGCAGTAGG + Intronic
1023901535 7:44484787-44484809 ATGTAGGATGGGAGGTCAGTTGG - Intronic
1024359655 7:48455014-48455036 CTGCAGGACGGGCGGGAGGAAGG - Intronic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1026187262 7:68091591-68091613 CTGAATGACGGGAGGTCAGGAGG + Intergenic
1026909962 7:74085725-74085747 CTGCAGGGTGGGAAGGGAGTTGG - Intronic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028087462 7:86653976-86653998 CTGCAGATCTAGAGGGCAGTGGG - Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1029436204 7:100565329-100565351 CTCATGGACGGGAGCGCAGTGGG + Exonic
1029577195 7:101411417-101411439 CTGCAGGCTGGGAGGGCAGGAGG + Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031891392 7:127297205-127297227 CTGCAGGATTTGGGGGCAGTGGG + Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032424070 7:131806478-131806500 CTCCAGGAGGGAGGGGCAGTAGG + Intergenic
1034997726 7:155589010-155589032 CTGCAGCACTGGTGGCCAGTTGG - Intergenic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1036396838 8:8377441-8377463 AGGCAGGATGGGTGGGCAGTGGG + Exonic
1037491100 8:19397824-19397846 CTGCAGCAGGGTAGGGCAGGAGG - Intergenic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1037627709 8:20622483-20622505 CTACAGGACACAAGGGCAGTGGG + Intergenic
1037712315 8:21364671-21364693 CTGCAGGACAGAAAGGCACTGGG - Intergenic
1037771233 8:21801296-21801318 CTGCAGGACTGGGAGGCAGGAGG + Intronic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1037993743 8:23338575-23338597 CTGCATGGCGGGAGGGAAGGGGG + Intronic
1038158279 8:25011889-25011911 CTGAGGGACGGGAAGGTAGTTGG - Intergenic
1040007043 8:42629497-42629519 CTGCTGGAGGGGAGGGGAGCTGG + Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1045839393 8:106561520-106561542 CTGCAGGAAGGGGCGGCTGTGGG + Intronic
1047213656 8:122859589-122859611 TTGAAGGAGGGGAGGGGAGTGGG + Intronic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048499697 8:134964346-134964368 CTGCATGACGAGAGCTCAGTTGG + Intergenic
1048767496 8:137860834-137860856 CTGGAGGAAGGGAGGAGAGTTGG + Intergenic
1048845771 8:138602609-138602631 CTGCAGGCCAGGTGGGAAGTAGG - Intronic
1049415621 8:142493537-142493559 CTTCAGGACAGGAGGACAGGAGG + Intronic
1049436252 8:142587497-142587519 CTGCAGAACGGGAGGGAGTTGGG + Intergenic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049799984 8:144513224-144513246 CTGCAGGAAGAGGTGGCAGTGGG + Exonic
1050019665 9:1269787-1269809 CTTGAGAACAGGAGGGCAGTGGG + Intergenic
1050130100 9:2403265-2403287 CTGGAGGAAGGGATGGCTGTGGG - Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056950319 9:91036312-91036334 CCCCAGGAGGGGAGGGCAGAAGG - Intergenic
1057146212 9:92761011-92761033 CTGCAGGAAGTGGGGGCAATAGG - Intronic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057215175 9:93223986-93224008 GTGCAGGATGGGAGGGCATCAGG - Intronic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1059451604 9:114374357-114374379 CTGGAGCATGAGAGGGCAGTGGG + Intronic
1060536576 9:124393998-124394020 CCGCAGGAACGCAGGGCAGTGGG + Intronic
1061181734 9:129028392-129028414 GGGCGGGACGGGACGGCAGTGGG + Intergenic
1061266071 9:129505730-129505752 CTCCAGGAGAGGAGGGCAGGGGG - Intergenic
1061396142 9:130344147-130344169 CTGCAGGTCGGGAGGGGTGATGG - Intronic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061750946 9:132776619-132776641 CTGCAGGATGGAAGGGCTGGAGG + Intronic
1062022950 9:134327638-134327660 CTGCAGGGAGGGTGGGCAGGAGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1187424502 X:19164760-19164782 CTGCAGGCTGGGAGGCCAGGTGG - Intergenic
1188435123 X:30150328-30150350 CTGGACGACGGGAATGCAGTGGG - Intergenic
1188531644 X:31147439-31147461 TTTCAGGAGGGGACGGCAGTGGG + Exonic
1198618542 X:138482571-138482593 GTGCAGGACGGGAGACCTGTGGG + Intergenic
1198807942 X:140507884-140507906 CTGCGGGAAGGCAGGGCAGCTGG + Intergenic