ID: 1119524024

View in Genome Browser
Species Human (GRCh38)
Location 14:75307968-75307990
Sequence AAGAGCGCCCTCTTCTGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119524024_1119524028 9 Left 1119524024 14:75307968-75307990 CCGAGCCAGAAGAGGGCGCTCTT No data
Right 1119524028 14:75308000-75308022 AAGGTTTGAAGGAAACCGCCAGG No data
1119524024_1119524027 -2 Left 1119524024 14:75307968-75307990 CCGAGCCAGAAGAGGGCGCTCTT No data
Right 1119524027 14:75307989-75308011 TTCAGCAAAACAAGGTTTGAAGG No data
1119524024_1119524029 22 Left 1119524024 14:75307968-75307990 CCGAGCCAGAAGAGGGCGCTCTT No data
Right 1119524029 14:75308013-75308035 AACCGCCAGGATGTTTCTGCAGG No data
1119524024_1119524026 -10 Left 1119524024 14:75307968-75307990 CCGAGCCAGAAGAGGGCGCTCTT No data
Right 1119524026 14:75307981-75308003 GGGCGCTCTTCAGCAAAACAAGG No data
1119524024_1119524031 26 Left 1119524024 14:75307968-75307990 CCGAGCCAGAAGAGGGCGCTCTT No data
Right 1119524031 14:75308017-75308039 GCCAGGATGTTTCTGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119524024 Original CRISPR AAGAGCGCCCTCTTCTGGCT CGG (reversed) Intergenic