ID: 1119525889

View in Genome Browser
Species Human (GRCh38)
Location 14:75321913-75321935
Sequence GGTACATTGGTGAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119525889_1119525895 21 Left 1119525889 14:75321913-75321935 CCCAGAGCCCTCACCAATGTACC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1119525895 14:75321957-75321979 TTTTCAAGAATTTTGCAAGCTGG 0: 1
1: 13
2: 50
3: 123
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119525889 Original CRISPR GGTACATTGGTGAGGGCTCT GGG (reversed) Intergenic
900987621 1:6082358-6082380 GGTGCATTTGTGAGCACTCTTGG - Intronic
901416964 1:9123103-9123125 GGTACAATGGTGCGATCTCTCGG - Intronic
903354929 1:22740775-22740797 GGTATGATGGTGAGGGGTCTGGG - Intronic
904416024 1:30361681-30361703 GGTACACTGGCTGGGGCTCTGGG - Intergenic
907570743 1:55480986-55481008 GGTGCTTAGGAGAGGGCTCTGGG + Intergenic
912601117 1:110934196-110934218 GGTACTATGTTGAGGGCTTTAGG + Intergenic
921124564 1:212166034-212166056 GAGGCATTGGTGAGGGCTCATGG - Intergenic
921785741 1:219227939-219227961 GCTACACTGTGGAGGGCTCTAGG - Intergenic
924281479 1:242441766-242441788 AGTACAATGGTGAGACCTCTTGG - Intronic
924908580 1:248483970-248483992 GCTCCAGTGGTGAGGACTCTTGG - Intergenic
924915532 1:248564092-248564114 GCTCCAGTGGTGAGGACTCTTGG + Intergenic
1062969900 10:1639348-1639370 GGGACATTCCTGAAGGCTCTGGG - Intronic
1063634690 10:7770458-7770480 GGTCCATTCATGAGGGTTCTTGG + Intronic
1067660331 10:48232635-48232657 GATTCATTGATGAGGGCCCTGGG - Intronic
1072396651 10:95049898-95049920 GGTACTATGTTGAGGGCTTTGGG + Intronic
1072495437 10:95953018-95953040 TGAATATTGGTGAAGGCTCTGGG - Intronic
1072682507 10:97517216-97517238 GGTCCAGTGGTAGGGGCTCTGGG + Intronic
1073860631 10:107734067-107734089 GATGTATTGGTGTGGGCTCTAGG - Intergenic
1077332681 11:1990303-1990325 GGTGCAGGGGTCAGGGCTCTGGG - Intergenic
1077410118 11:2400007-2400029 GGTGCATTGGTCCGGGCTCCGGG - Intergenic
1083722191 11:64608925-64608947 GCTACATGGGTGAGAGGTCTTGG + Intronic
1084768893 11:71329945-71329967 GGTACATGGGTGGGGAGTCTGGG - Intergenic
1087715704 11:101606300-101606322 GGTTCAGTGGTGAGGCCCCTGGG + Intronic
1088439916 11:109858697-109858719 GGTACCGTGGAGAGGGCACTGGG - Intergenic
1089325294 11:117652745-117652767 CGTGCATTGGTAAGGGCTGTGGG + Intronic
1089690009 11:120181283-120181305 GGTACATGAGTGAGTGATCTGGG - Intronic
1090388885 11:126374399-126374421 GGTACAATGGTGTGTGATCTTGG - Intronic
1091060201 11:132453896-132453918 GGAACATTGCTGATGACTCTTGG + Intronic
1202815664 11_KI270721v1_random:45479-45501 GGTGCAGGGGTCAGGGCTCTGGG - Intergenic
1092387937 12:8050559-8050581 GGTACATTGGTGATGGGCCAGGG - Exonic
1094129790 12:27062774-27062796 GGTTCATTGGAGAGTGATCTGGG - Intronic
1098492039 12:71093164-71093186 GGTACTATGTTGAGGGCTTTGGG - Intronic
1101232109 12:102752116-102752138 GGTTCATAGGTGAAGTCTCTAGG + Intergenic
1102315186 12:111881897-111881919 GTAACATTGGTGAGGTCACTTGG + Intronic
1102779690 12:115553395-115553417 GGTGCAGGGGTGAGGGCTTTGGG - Intergenic
1103969260 12:124659877-124659899 GGGACATTGGTGGGGACTCTTGG - Intergenic
1104584639 12:130038186-130038208 GAGACATTGGGGAGGGCTCCTGG - Intergenic
1107888449 13:44893845-44893867 GGTGCATTAGTGATGGCCCTCGG + Intergenic
1116779643 14:49222521-49222543 GAAAAATTGGTGAGGGCTCTAGG - Intergenic
1118320486 14:64749535-64749557 GCAACAATGGTGGGGGCTCTTGG + Exonic
1119525889 14:75321913-75321935 GGTACATTGGTGAGGGCTCTGGG - Intergenic
1120336488 14:83163382-83163404 TGTAAATTTGTGAGGGTTCTAGG - Intergenic
1124635342 15:31361338-31361360 GTTACCTTGGTGAGGTCACTTGG + Intronic
1125727100 15:41873739-41873761 GGATCAGTGGTGGGGGCTCTGGG - Intronic
1130136265 15:81184326-81184348 AGTTCATTGGTGTGTGCTCTGGG + Intronic
1130171183 15:81516279-81516301 GGGACATTGTTGAAGGCTCAGGG + Intergenic
1130880741 15:88053545-88053567 GGTACGTTGGTCAGGGGTATGGG + Intronic
1134082368 16:11333875-11333897 GGTTTATTGGGGAGTGCTCTTGG - Intronic
1136995613 16:35186571-35186593 GGGACATTGGTATTGGCTCTGGG + Intergenic
1149015895 17:51907834-51907856 AGTTCATTGGAAAGGGCTCTTGG - Intronic
1150442592 17:65203287-65203309 GGTGCAGTGGGGAGGGCTGTCGG + Intronic
1152023627 17:77794973-77794995 GGGAGATTGGTGAGGGCTGCAGG - Intergenic
1153825636 18:8871613-8871635 GGCACATTGGTGGTGGCTGTTGG - Intergenic
1155984784 18:32218583-32218605 GGTTTATTGGGGAGGGCTCCTGG + Intronic
1156758355 18:40556497-40556519 GGTAGATTGGGGAGGGATGTAGG - Intergenic
1157313899 18:46572682-46572704 GGCACTGTGCTGAGGGCTCTGGG + Intronic
1159731385 18:72032892-72032914 GGTACTATGTTGAGGGCTTTGGG - Intergenic
1160507038 18:79432979-79433001 GGTACGACGGTGAGGGCTGTGGG - Intronic
1161384476 19:3983674-3983696 GGTACATTGGTGAGGGACTCTGG - Intronic
1164603510 19:29579487-29579509 GGTAAATAGCTGAGGACTCTGGG - Intergenic
1165178709 19:33949154-33949176 GGGACACTTGTGAGGGCTCCTGG - Intergenic
1166048417 19:40243164-40243186 GGGAAATTGGTGATCGCTCTTGG - Intronic
1168245265 19:55109976-55109998 GATACATTGGTGGGGGATATTGG - Intronic
925568501 2:5283404-5283426 GGTACATTGGACATTGCTCTGGG - Intergenic
927050993 2:19329036-19329058 GGTACTCTGGTGATGACTCTGGG - Intergenic
927067220 2:19485298-19485320 GGTACAATGGCAAGGGGTCTGGG + Intergenic
927338372 2:21951826-21951848 GGAACTCAGGTGAGGGCTCTGGG - Intergenic
927605465 2:24482737-24482759 GATACATGGGTGAGAGCTCATGG - Intergenic
929547445 2:42864794-42864816 GATACATTGGGGCGGGCTCTTGG + Intergenic
933387836 2:81634232-81634254 GGTACTATGTTGAGGGCTGTGGG + Intergenic
940072926 2:149709719-149709741 AGTACAGTGGAAAGGGCTCTAGG - Intergenic
940198379 2:151122495-151122517 GATACATTCCTCAGGGCTCTAGG - Intergenic
940413168 2:153389744-153389766 GGTACATTGGAGAGAGCGCTGGG + Intergenic
941765722 2:169294050-169294072 GGTACATTGGTGGGGGAGCGGGG + Intronic
942489384 2:176474567-176474589 GGTACCTTGGTGGGAGCTCAGGG + Intergenic
942516964 2:176764332-176764354 GGCACATTGGTGGGGGGTCGGGG + Intergenic
943596594 2:189864830-189864852 GGTACATTAGTGACTTCTCTAGG + Intronic
945188676 2:207165390-207165412 GCTGCGTTGGTGTGGGCTCTGGG - Intronic
949031483 2:241799336-241799358 GGGCCTTTGGGGAGGGCTCTGGG + Intronic
1168796736 20:615164-615186 GGCAAATTGGTGATGGCTGTAGG - Intergenic
1170412110 20:16103110-16103132 GGTACATGGGTGAGGGTTTCAGG + Intergenic
1172120292 20:32594419-32594441 GGTACATCCGTCAGGGCTCATGG - Intronic
1174641307 20:52046785-52046807 TGTACATTGCACAGGGCTCTGGG + Intergenic
1175659932 20:60803807-60803829 GGCACAGCAGTGAGGGCTCTTGG + Intergenic
1179439354 21:41382363-41382385 GGATCATTAATGAGGGCTCTGGG + Intronic
1180089335 21:45525747-45525769 GGGACATTGTTGAGGCCTCCTGG - Intronic
1180907254 22:19423080-19423102 GGATTATTGGGGAGGGCTCTCGG - Intronic
1182012206 22:27010321-27010343 GGGTCATTGGTCAGGGCTTTGGG + Intergenic
1184241211 22:43212172-43212194 GGAGCACTGGGGAGGGCTCTGGG - Intronic
1184760273 22:46539710-46539732 GGCACATTCAGGAGGGCTCTGGG + Intergenic
1185082690 22:48718563-48718585 GGTACTCTGGGGAGTGCTCTGGG - Intronic
950269303 3:11600959-11600981 GGTACAGTGGTGAGGGCGGTTGG - Intronic
952205874 3:31181282-31181304 GGGACAGTGGTGAGGGTGCTGGG - Intergenic
952429846 3:33212642-33212664 AGGACATTGGTTAGGGCTGTTGG + Intronic
952746638 3:36787912-36787934 CCTGCATTGGTGGGGGCTCTGGG - Intergenic
953376764 3:42435439-42435461 GGTAGTTTGGAGAGGTCTCTGGG - Intergenic
953683307 3:45056600-45056622 TGTATCTTGATGAGGGCTCTGGG - Intergenic
953984510 3:47431033-47431055 TGTGCCTTAGTGAGGGCTCTGGG + Intronic
954374908 3:50188980-50189002 GGTAGATGGGTGGGGGCTCCTGG + Exonic
965649139 3:170915290-170915312 GGTAGATTAGTTAGGGTTCTTGG + Intergenic
966890193 3:184401690-184401712 GGTACAGCGGTGAGGGCTGTAGG + Intronic
969053823 4:4389422-4389444 GGTACAAGGGTTATGGCTCTTGG + Intronic
969500877 4:7552224-7552246 GGTATATTGCTGAGGGTCCTTGG + Intronic
974337601 4:60570205-60570227 GGTACTATGTTGAGGGCTTTGGG - Intergenic
978546960 4:109880366-109880388 GGTGCCTTGATGTGGGCTCTGGG - Intergenic
981658939 4:147144061-147144083 CCTATATTGGTGAGGGCTGTGGG + Intergenic
981929720 4:150176317-150176339 GGCACAGTGCTGAGTGCTCTGGG + Intronic
982305037 4:153922021-153922043 GGTGGATTGGTGATGGCTATAGG + Intergenic
982319794 4:154066452-154066474 GGTACATTGATCTTGGCTCTAGG + Intergenic
986890194 5:12294627-12294649 GGTAGATTAGTGAGGGATTTAGG - Intergenic
990861843 5:60335985-60336007 GGTCACTTGGTCAGGGCTCTGGG + Intronic
991061965 5:62385594-62385616 GTTACAGTAGTGAGGGTTCTGGG - Exonic
992077142 5:73202144-73202166 GTCCCATTGGAGAGGGCTCTGGG - Intergenic
994230643 5:97307558-97307580 GATGTATTGGTGAGTGCTCTTGG + Intergenic
994564540 5:101425272-101425294 TGTACATTGGTGAGGGAAATTGG - Intergenic
995059134 5:107794978-107795000 GGAACATTAGTCAGGGCTATGGG + Intergenic
999586984 5:153100377-153100399 AGTACATTAGTCAGAGCTCTTGG - Intergenic
1000098725 5:157994247-157994269 GGCACATTGTTGAGGGCTGTGGG - Intergenic
1000513278 5:162209430-162209452 GGTACACTGGCGAGGGGTGTGGG - Intergenic
1011262789 6:85486082-85486104 GGTACGTTAGTGAGGGATTTAGG + Intronic
1014207648 6:118673566-118673588 GGCACAATGGTGAGGTCTGTGGG + Intronic
1019433665 7:1011121-1011143 GGTACATGGGTGAGGGTTGGGGG - Intronic
1024606041 7:51023515-51023537 GGGCCATTTGTGATGGCTCTTGG - Intronic
1024914628 7:54485327-54485349 GGAAAAATAGTGAGGGCTCTTGG - Intergenic
1025572749 7:62597606-62597628 GGGATATTTGTGAGCGCTCTTGG - Intergenic
1028069478 7:86433694-86433716 GGTACATTGGAGAATGCTCTCGG - Intergenic
1030235936 7:107262225-107262247 GGTACATTTGGGAGGTCTCAAGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1032474055 7:132200311-132200333 GGTTTCTTGTTGAGGGCTCTGGG + Intronic
1041834435 8:62195908-62195930 GTTACAAGGGTGAAGGCTCTAGG - Intergenic
1044741047 8:95326706-95326728 GCGACATTGTTGAGGCCTCTTGG + Intergenic
1045987090 8:108261480-108261502 GGTCCAGTGGAGAGGGCTCGGGG - Intronic
1048206559 8:132420141-132420163 GGGAGATGGGAGAGGGCTCTGGG + Intronic
1048439659 8:134450614-134450636 GGAACCTGGGTGAGGGCTTTTGG - Intergenic
1050720892 9:8587974-8587996 GGTAGATTGTTGAAGGCTCTTGG - Intronic
1050882096 9:10714701-10714723 GGTACATCACTGAAGGCTCTTGG - Intergenic
1058144073 9:101391129-101391151 GGTAGATTGGGGTGGGATCTTGG - Intronic
1061382025 9:130264554-130264576 GAGACATGGCTGAGGGCTCTAGG - Intergenic
1062368347 9:136222858-136222880 GGGACAGGGGTGAGGGGTCTGGG + Intronic
1190337300 X:49270163-49270185 GGCACAGCGGTGAGGGCTCGGGG - Exonic
1191574504 X:62682825-62682847 GGGACATTTGTGAGTGCTTTGGG + Intergenic
1199084114 X:143609226-143609248 GATACATTGGTGAAGGCCATAGG - Intergenic
1199173594 X:144758703-144758725 GGGCCTTGGGTGAGGGCTCTTGG + Intergenic