ID: 1119527219

View in Genome Browser
Species Human (GRCh38)
Location 14:75332444-75332466
Sequence GGGATTAAGCAGATGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119527219_1119527227 27 Left 1119527219 14:75332444-75332466 CCATGTCCCATCTGCTTAATCCC No data
Right 1119527227 14:75332494-75332516 TGACACCATATCATTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119527219 Original CRISPR GGGATTAAGCAGATGGGACA TGG (reversed) Intergenic
No off target data available for this crispr