ID: 1119527324

View in Genome Browser
Species Human (GRCh38)
Location 14:75333138-75333160
Sequence TCCCTGAGAGGACGATCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119527324_1119527332 22 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527332 14:75333183-75333205 GTTAGGGACATGTACTATGAAGG No data
1119527324_1119527326 -10 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527326 14:75333151-75333173 CTCTCAGGGAGTTGCTCTATTGG No data
1119527324_1119527331 6 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527331 14:75333167-75333189 CTATTGGTGGGTCGAGGTTAGGG No data
1119527324_1119527329 0 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527329 14:75333161-75333183 GTTGCTCTATTGGTGGGTCGAGG No data
1119527324_1119527328 -6 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527328 14:75333155-75333177 CAGGGAGTTGCTCTATTGGTGGG No data
1119527324_1119527327 -7 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527327 14:75333154-75333176 TCAGGGAGTTGCTCTATTGGTGG No data
1119527324_1119527330 5 Left 1119527324 14:75333138-75333160 CCTCTTGATCGTCCTCTCAGGGA No data
Right 1119527330 14:75333166-75333188 TCTATTGGTGGGTCGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119527324 Original CRISPR TCCCTGAGAGGACGATCAAG AGG (reversed) Intergenic
No off target data available for this crispr