ID: 1119531856

View in Genome Browser
Species Human (GRCh38)
Location 14:75367330-75367352
Sequence TTGACTCTGAAGGACATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119531852_1119531856 9 Left 1119531852 14:75367298-75367320 CCTGATGGTGTTAGCAGTGTTGA No data
Right 1119531856 14:75367330-75367352 TTGACTCTGAAGGACATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119531856 Original CRISPR TTGACTCTGAAGGACATGGT GGG Intergenic
No off target data available for this crispr