ID: 1119535690

View in Genome Browser
Species Human (GRCh38)
Location 14:75400905-75400927
Sequence TGATGTCTGCTCCCCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119535688_1119535690 5 Left 1119535688 14:75400877-75400899 CCTTTCAGAAGAAGGATCTCAGT No data
Right 1119535690 14:75400905-75400927 TGATGTCTGCTCCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119535690 Original CRISPR TGATGTCTGCTCCCCTGCCC TGG Intergenic
No off target data available for this crispr