ID: 1119537194

View in Genome Browser
Species Human (GRCh38)
Location 14:75412196-75412218
Sequence ATGTTATCACTGTGATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119537194_1119537201 9 Left 1119537194 14:75412196-75412218 CCACCCAATCACAGTGATAACAT No data
Right 1119537201 14:75412228-75412250 AAGAAGTGGCGTGGGTTACCAGG No data
1119537194_1119537199 1 Left 1119537194 14:75412196-75412218 CCACCCAATCACAGTGATAACAT No data
Right 1119537199 14:75412220-75412242 GTACCAAAAAGAAGTGGCGTGGG No data
1119537194_1119537197 -5 Left 1119537194 14:75412196-75412218 CCACCCAATCACAGTGATAACAT No data
Right 1119537197 14:75412214-75412236 AACATCGTACCAAAAAGAAGTGG No data
1119537194_1119537198 0 Left 1119537194 14:75412196-75412218 CCACCCAATCACAGTGATAACAT No data
Right 1119537198 14:75412219-75412241 CGTACCAAAAAGAAGTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119537194 Original CRISPR ATGTTATCACTGTGATTGGG TGG (reversed) Intergenic
No off target data available for this crispr