ID: 1119538020

View in Genome Browser
Species Human (GRCh38)
Location 14:75418994-75419016
Sequence CTGAAATATACTCTCGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119538019_1119538020 -10 Left 1119538019 14:75418981-75419003 CCAACTCTGTGGTCTGAAATATA No data
Right 1119538020 14:75418994-75419016 CTGAAATATACTCTCGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119538020 Original CRISPR CTGAAATATACTCTCGTACA CGG Intergenic