ID: 1119538908

View in Genome Browser
Species Human (GRCh38)
Location 14:75426339-75426361
Sequence GTACTTGATGTGTCTTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119538908_1119538912 25 Left 1119538908 14:75426339-75426361 CCAGCTGAAGACACATCAAGTAC No data
Right 1119538912 14:75426387-75426409 CCATATAAACATCCAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119538908 Original CRISPR GTACTTGATGTGTCTTCAGC TGG (reversed) Intergenic
No off target data available for this crispr