ID: 1119539089

View in Genome Browser
Species Human (GRCh38)
Location 14:75427486-75427508
Sequence TGTCCAAGGATGAAACTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119539083_1119539089 2 Left 1119539083 14:75427461-75427483 CCTCCTCACCCGCTCAGTCCTGA No data
Right 1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG No data
1119539085_1119539089 -6 Left 1119539085 14:75427469-75427491 CCCGCTCAGTCCTGAAGTGTCCA No data
Right 1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG No data
1119539086_1119539089 -7 Left 1119539086 14:75427470-75427492 CCGCTCAGTCCTGAAGTGTCCAA No data
Right 1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG No data
1119539084_1119539089 -1 Left 1119539084 14:75427464-75427486 CCTCACCCGCTCAGTCCTGAAGT No data
Right 1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119539089 Original CRISPR TGTCCAAGGATGAAACTGTG CGG Intergenic
No off target data available for this crispr