ID: 1119539270

View in Genome Browser
Species Human (GRCh38)
Location 14:75428125-75428147
Sequence TGCCCAGGCCTGTCCCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 418}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119539270_1119539285 19 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539285 14:75428167-75428189 CGGGCGGCAGCGGCGCGGAGCGG 0: 1
1: 0
2: 8
3: 88
4: 1163
1119539270_1119539279 0 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539279 14:75428148-75428170 CCGGGCGGAGCTCCGCGGCCGGG 0: 1
1: 0
2: 0
3: 20
4: 253
1119539270_1119539283 14 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539283 14:75428162-75428184 GCGGCCGGGCGGCAGCGGCGCGG 0: 1
1: 0
2: 12
3: 107
4: 614
1119539270_1119539286 20 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539286 14:75428168-75428190 GGGCGGCAGCGGCGCGGAGCGGG 0: 1
1: 1
2: 8
3: 97
4: 624
1119539270_1119539280 3 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539280 14:75428151-75428173 GGCGGAGCTCCGCGGCCGGGCGG 0: 1
1: 0
2: 4
3: 21
4: 221
1119539270_1119539276 -5 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539276 14:75428143-75428165 GGGCACCGGGCGGAGCTCCGCGG 0: 1
1: 0
2: 2
3: 14
4: 207
1119539270_1119539277 -1 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539277 14:75428147-75428169 ACCGGGCGGAGCTCCGCGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 75
1119539270_1119539287 25 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539287 14:75428173-75428195 GCAGCGGCGCGGAGCGGGCACGG 0: 1
1: 0
2: 4
3: 35
4: 297
1119539270_1119539281 9 Left 1119539270 14:75428125-75428147 CCGGGCCGGGACAGGCCTGGGCA 0: 1
1: 0
2: 0
3: 46
4: 418
Right 1119539281 14:75428157-75428179 GCTCCGCGGCCGGGCGGCAGCGG 0: 1
1: 0
2: 0
3: 21
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119539270 Original CRISPR TGCCCAGGCCTGTCCCGGCC CGG (reversed) Intronic
900038807 1:439909-439931 TGCCCAGCCCTGTGTCAGCCAGG + Intergenic
900060240 1:674885-674907 TGCCCAGCCCTGTGTCAGCCAGG + Intergenic
900251004 1:1669676-1669698 TGGCCATGCTCGTCCCGGCCCGG - Exonic
900301076 1:1977647-1977669 TGCCCAGGCCAGCCTCGGACAGG - Intronic
900318088 1:2069346-2069368 TGCCCAGGACCCTCCCTGCCAGG - Intronic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
900613701 1:3555011-3555033 TGCCCGGCCCTCTCCCGTCCTGG + Intronic
901868749 1:12125312-12125334 AGCCCAGGCCAGGCCAGGCCGGG - Intronic
902269716 1:15294681-15294703 TGCACAGGCCGGGCCAGGCCTGG - Intronic
902874746 1:19334042-19334064 TCCCCAGGGCTGTCCCAGGCTGG - Intergenic
903554627 1:24184469-24184491 TGGCCTGGCCTGGCCTGGCCAGG + Intronic
903685571 1:25129301-25129323 TGCCCAGCCATCTCCCTGCCTGG + Intergenic
903886929 1:26546132-26546154 GGCCCAGGCCTGGCCCTGCAGGG + Intronic
903969783 1:27111108-27111130 TGGCCAGGCCTGGTGCGGCCTGG + Intronic
904296129 1:29520917-29520939 TGCCCACCCCTGTCCCTGACCGG - Intergenic
904435563 1:30492618-30492640 TGCCTAGGCCTGCCCCGTCTAGG - Intergenic
905003075 1:34688620-34688642 TGCCCAGGTCTGTCTGGCCCTGG - Intergenic
906526741 1:46497987-46498009 AGCCCAGGCAGGGCCCGGCCTGG + Intergenic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
914857879 1:151365401-151365423 GGCCCAGGACTGTCCAGGCCAGG - Intronic
915016432 1:152738151-152738173 GGCCCAGCCCTGTCCTGGCTGGG + Intronic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
916497841 1:165361107-165361129 TGCCTAGGGCTGTCCTTGCCAGG - Intergenic
918580384 1:186120102-186120124 TGCCCAAGGCTGTACCAGCCGGG - Exonic
919455376 1:197814757-197814779 GGCCAAAGCCTGTCCCGGACTGG + Intergenic
920100782 1:203515775-203515797 TTCCCAGGCCTGTCCCTGGCAGG - Intergenic
920674459 1:208029536-208029558 TTCCCAGGGCTGGCCTGGCCTGG + Intronic
922461271 1:225816000-225816022 TGCCAAGGACTGGCCCGGCATGG + Intronic
922705344 1:227787602-227787624 TCGCCCTGCCTGTCCCGGCCCGG - Intergenic
922727118 1:227927752-227927774 TCCCCAGGCCTGGACCCGCCAGG + Intronic
922739355 1:228006855-228006877 TGCCCCTGCCTGCCCCGCCCGGG + Intergenic
923125686 1:231032780-231032802 ACCCCAGGCCTGTCCCAGCCAGG - Intronic
1063380662 10:5583565-5583587 TGCTGGGGGCTGTCCCGGCCTGG + Intergenic
1063465651 10:6242382-6242404 TGGCCAGGCCCGTCCTGGGCAGG - Intergenic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1063773850 10:9237988-9238010 TGGCCTGGCCTGGCCTGGCCTGG - Intergenic
1069651720 10:70053777-70053799 TGCCCAGGCGAGCCACGGCCGGG - Intronic
1070288343 10:75099484-75099506 TGCCCAGCCCTGTTCCGCTCAGG - Intronic
1071524102 10:86348211-86348233 TGCCTAGGCCTGTACAGGCCTGG + Intronic
1071604313 10:86974226-86974248 TGCCCAGGCCTGTCTCCACCAGG + Intronic
1072619976 10:97073457-97073479 AGCCAGGGCCTGTCCCAGCCCGG + Intronic
1073180282 10:101579238-101579260 TGCCCAGCCCTCTCCCAGACAGG - Exonic
1073443303 10:103565347-103565369 TGCTCAGGCCGGGCCGGGCCTGG + Intronic
1075078569 10:119368027-119368049 TGCCCAGCCGTTTCCTGGCCCGG + Intronic
1075106459 10:119542885-119542907 TGCCCTGCCCTGCCCCGCCCGGG - Intergenic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1076096285 10:127737024-127737046 CGCCCAGGCCTGACACGTCCTGG - Intergenic
1076683661 10:132187319-132187341 CGCCCAGGCCCGGCCCGGCCCGG + Intronic
1076722208 10:132397570-132397592 CGCCCCGGCCCGCCCCGGCCCGG - Intronic
1076882288 10:133245411-133245433 TGCCCAGCTCTGTCCCTGCAAGG - Intergenic
1076965015 11:75820-75842 TGCCCAGCCCTGTGTCAGCCAGG + Intergenic
1077164830 11:1130333-1130355 TGCCCAGGCCTGTCTTGGGATGG - Intergenic
1077287375 11:1773542-1773564 CACCCAGGCCTGTCCAGCCCTGG - Intergenic
1077297069 11:1831382-1831404 TGCCCAGGGCAGCCCCCGCCCGG + Intronic
1077301385 11:1848744-1848766 TGCCCAGGCCTCTCCCTGCTCGG + Intergenic
1077376756 11:2208903-2208925 TGCCCAGTCCTGGTCCGGCATGG + Intergenic
1077491326 11:2862319-2862341 TGGCCCGGCCAGGCCCGGCCCGG + Intergenic
1077491329 11:2862324-2862346 CGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1081667471 11:44925016-44925038 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1081869849 11:46378372-46378394 TGGACAGGACTGTGCCGGCCAGG - Intronic
1083861695 11:65423413-65423435 GGCCCAGGCCGGGCCCAGCCTGG + Intergenic
1084032082 11:66487058-66487080 TGCCCAGGCCTCTCTCTGGCTGG - Intronic
1084150586 11:67286218-67286240 TGCCCAGGACGGGGCCGGCCAGG + Exonic
1084174593 11:67416672-67416694 CTGCCAGGCCTGTCCAGGCCTGG + Intronic
1084174596 11:67416675-67416697 TCCCCAGGCCTGGACAGGCCTGG - Intronic
1084548205 11:69825051-69825073 AGTCCTGGCCTGGCCCGGCCGGG + Intergenic
1084814671 11:71639263-71639285 TGGCCAGGCCAGCTCCGGCCAGG - Intergenic
1084961857 11:72721069-72721091 AGCCCAGGCCTGGCCTGGCCTGG + Intronic
1085186767 11:74582378-74582400 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1085186769 11:74582381-74582403 TACCCAGGCCAGGCCAGGCCAGG - Intronic
1085472639 11:76768008-76768030 GGTCCAGGCCTGGCCTGGCCAGG - Intergenic
1089590916 11:119540321-119540343 TCCCCAGGCCTATCCTGACCAGG + Intergenic
1090208012 11:124896460-124896482 TACCCAGGTCTGCCCAGGCCAGG + Intronic
1092529862 12:9335270-9335292 TGACCAGGTCTGTCCCTGCCAGG + Intergenic
1096149123 12:49297625-49297647 TGCCCAGGCCCCGCCCTGCCCGG - Intronic
1097267834 12:57755877-57755899 TGCCCAGGCCTGACCTGCTCCGG - Exonic
1098383618 12:69895701-69895723 TGCCCTGCCCTGTCTCTGCCTGG + Intronic
1100404953 12:94264500-94264522 TGCCCGGGCCGGGCCTGGCCTGG + Intronic
1100404955 12:94264503-94264525 GGGCCAGGCCAGGCCCGGCCCGG - Intronic
1102146980 12:110661510-110661532 TGCAGTGGCCTGGCCCGGCCTGG - Intronic
1103608445 12:122106025-122106047 TGCCCAGGCCAGCCCCTGGCTGG + Intronic
1103905654 12:124326161-124326183 AGCCCAGCCCTGTCCCCACCTGG + Intronic
1104062800 12:125282299-125282321 TGCCCCCGCCTTCCCCGGCCTGG + Intronic
1104491227 12:129195243-129195265 CTCCCAGGCCTGTGCCTGCCTGG - Intronic
1104918055 12:132276241-132276263 TGCCCGGCTCTGTCCAGGCCTGG - Intronic
1105006915 12:132727309-132727331 CGCCCAGGACTGCCCAGGCCTGG + Exonic
1112344223 13:98576913-98576935 AGCCCTGGCGGGTCCCGGCCGGG + Intronic
1113427616 13:110222322-110222344 CGCCCGGGCCTGTCACGGGCTGG - Intronic
1113839304 13:113349750-113349772 GGCCCAGGGCTGTCCAGGCAGGG + Intronic
1114317617 14:21522958-21522980 TGGCCAGGCCTTTCCCTCCCAGG - Exonic
1114671236 14:24412156-24412178 TGCCCAGCCCTTCCCAGGCCTGG - Intronic
1115641255 14:35337000-35337022 TGCCCAGGCCTGTCTCCTCCCGG + Intergenic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1119744653 14:77035445-77035467 TGCCCAGGCCTGTCTCTTCTGGG + Intergenic
1120873153 14:89355965-89355987 TGCCCAGGCCTGTTCTGCCCTGG + Intronic
1121022391 14:90588223-90588245 TGGCCTGGCCTGGCCTGGCCTGG - Intronic
1121022394 14:90588228-90588250 GGCCCTGGCCTGGCCTGGCCTGG - Intronic
1122268039 14:100555830-100555852 TGCCCAGGCCTGGGCGGGCACGG - Intronic
1122505493 14:102229225-102229247 CACCCAGGCCTGGCCCGGTCGGG + Exonic
1122739051 14:103860215-103860237 TGCCCCTGCCTTTCCTGGCCAGG + Intergenic
1122792544 14:104190441-104190463 TTCCCATGCATGTCCTGGCCGGG - Intergenic
1123055143 14:105566014-105566036 TGCCCAGGCCTGGCCAACCCAGG - Intergenic
1123079592 14:105685858-105685880 TGCCCAGGCCTGGCCAACCCAGG - Intergenic
1124251290 15:28107675-28107697 TGCCCCGGGCTATCCCGGGCTGG + Intergenic
1124416461 15:29476558-29476580 TGTCCAGGTCTGGCCCTGCCTGG - Intronic
1126497329 15:49306635-49306657 TGCCTAGGGCTGGCCTGGCCTGG - Intronic
1126686211 15:51251065-51251087 TTCCCAGGCCTGCCACGCCCGGG + Intronic
1128236385 15:66070390-66070412 TGCCCAAGCCTGTCCTGGCTAGG + Intronic
1128719844 15:69940357-69940379 TGCCCAGCCCAGTCCAGGCATGG + Intergenic
1130062585 15:80580536-80580558 TGCCCATACCTGTCCCGGAAAGG - Exonic
1130540318 15:84817267-84817289 TCCCCTGGCCTGGCCCGACCCGG - Exonic
1131063130 15:89416691-89416713 TTCCCAGGCCAGGCCCCGCCGGG - Intergenic
1131263500 15:90902577-90902599 TGGCCAGGCCCGGCCCGGGCTGG + Intronic
1131461709 15:92622341-92622363 TGTCCAGGCCTGACCTGGGCAGG - Intronic
1132181196 15:99754087-99754109 TGCCCAGGCCTGCCTCTGCTAGG - Intergenic
1132346632 15:101112647-101112669 TGCCCCTGCCTGTCACGACCTGG - Intergenic
1132443108 15:101887696-101887718 TGCCCAGCCCTGTGTCAGCCAGG - Intergenic
1132463355 16:66457-66479 GTCCCAGGCCTGTCCCTGGCTGG - Intronic
1132463675 16:67956-67978 TCCCCAGGACTGTTTCGGCCGGG + Intronic
1132463691 16:68002-68024 TCCCCAGGACTGTCTCAGCCGGG + Intronic
1132463706 16:68048-68070 TCCCCAGGACTGTCTCAGCCGGG + Intronic
1132570571 16:642263-642285 GGCCCCGGCCCGGCCCGGCCCGG + Intronic
1132578137 16:673319-673341 TGCCCAGGCATGTCCCTCCAGGG + Intronic
1132654904 16:1037680-1037702 GGCCCAGGCCTGACCGGGACCGG - Intergenic
1132675592 16:1120036-1120058 TGGCCAGGCCTCTCCAGGCCAGG - Intergenic
1132699787 16:1217475-1217497 GGCCCAGCCCTGCCCCTGCCGGG + Intronic
1132873655 16:2126384-2126406 GGCCCAGCCCTGGCCCAGCCTGG - Intronic
1132888564 16:2193535-2193557 TCCCCAGGACTGTCCAAGCCAGG + Intronic
1133188190 16:4115452-4115474 TCCCGGGGCCTGCCCCGGCCGGG + Exonic
1133225453 16:4338402-4338424 TGCCCAGGCCAGGCCCAGCGGGG - Exonic
1134132518 16:11659279-11659301 GGCCCTGGCCTGTCCTGGCTGGG - Intergenic
1134520505 16:14917334-14917356 CCCCCAGGCCTCTCCCGGCTTGG + Intronic
1134551069 16:15138640-15138662 CCCCCAGGCCTCTCCCGGCTTGG - Intronic
1134552743 16:15145558-15145580 GGCCCAGCCCTGGCCCAGCCTGG - Intergenic
1134708177 16:16315985-16316007 CCCCCAGGCCTCTCCCGGCTTGG + Intergenic
1134951425 16:18352660-18352682 CCCCCAGGCCTCTCCCGGCTTGG - Intergenic
1135133548 16:19871778-19871800 TCCCCCGGCCTGACCCAGCCGGG + Intronic
1135514731 16:23121445-23121467 AGCCTAGGCCTGGCCTGGCCCGG + Intronic
1136356135 16:29745752-29745774 TCCGGAGGCCTGGCCCGGCCCGG - Intronic
1137626631 16:49912908-49912930 TGCACAGGGCTGGCCTGGCCAGG - Intergenic
1137686485 16:50390443-50390465 TGCCCAGGCCTTGCCCAGCTGGG + Intergenic
1137738494 16:50742341-50742363 TGCCCGGGCCCGAGCCGGCCGGG + Intronic
1137968276 16:52958482-52958504 TGCCCAGGCTGGTCCTGGGCTGG - Intergenic
1139505759 16:67397414-67397436 GGCCCAGGCCTGCCCAGTCCTGG + Intronic
1139528470 16:67530226-67530248 AGCCCTGGCCAGGCCCGGCCCGG + Intronic
1141101749 16:81202570-81202592 TGCTCCGGCCTGTCCCAGTCAGG - Intergenic
1141703536 16:85653035-85653057 TGCCCAGGCCTACCCTGACCTGG - Intronic
1141722250 16:85763022-85763044 TGCCCAGGCCAGCCCCAGCAGGG - Intergenic
1142052326 16:87966911-87966933 AGCCCAGGCCCCTCCCGTCCAGG - Intronic
1142134366 16:88444835-88444857 TTTCCAGGCCTGCCCTGGCCTGG + Intergenic
1142215715 16:88828875-88828897 GCCCCAGCCCTGTCCCGGCCTGG + Intronic
1142261194 16:89043205-89043227 TGGCCAGGTCTGGGCCGGCCTGG + Intergenic
1142281525 16:89150669-89150691 TGCCCAGTCCTGTCCCTCACAGG - Intronic
1142358120 16:89613670-89613692 TGCCTAGGCCGGGCCCTGCCAGG + Intronic
1142614328 17:1125953-1125975 TGCCCAGGCCTGGCAGGGACAGG + Intronic
1143023780 17:3929566-3929588 TGCCAGGGCCTGTCCCGGGCTGG + Intronic
1144143784 17:12377261-12377283 TGGCCTGGCCTGGCCTGGCCTGG - Intergenic
1146928577 17:36762109-36762131 GGCCCAGGCTTGTCCAGGCCTGG + Intergenic
1147647145 17:42040619-42040641 GGCCGAGGCCTGGCCTGGCCTGG - Intronic
1147884478 17:43675579-43675601 TGCCCAGGCCAGCCCTGTCCGGG - Intergenic
1148107601 17:45127677-45127699 TGTCCAGGCGTGTCCCGGAGGGG + Intronic
1149549765 17:57531751-57531773 TGACCAGCCCTCTCCCTGCCCGG - Intronic
1151624042 17:75265577-75265599 TCCCCAGGCCTGACCAGGGCTGG + Intronic
1151661587 17:75521875-75521897 GCCCCAGCCCTGGCCCGGCCAGG + Exonic
1151748144 17:76022507-76022529 TGCGCAGGCCAGTACGGGCCGGG - Exonic
1151763661 17:76121576-76121598 CGGCCCGGCCTGGCCCGGCCCGG - Intronic
1151853786 17:76707997-76708019 TGCCCTGGCCTGTGCTGCCCTGG + Intronic
1152364042 17:79844889-79844911 TGCCCAGGCAGGGCCCGGGCAGG + Intergenic
1152553684 17:81042541-81042563 TGTCCAGGCGTGCCCCTGCCTGG + Intronic
1152614626 17:81332057-81332079 TGCCCAGGGCTGTCCAGCCAGGG - Intergenic
1152802736 17:82339489-82339511 TGGCCGTGCCTGTCCCGGCCAGG + Intergenic
1154069173 18:11137649-11137671 TTCCCTGGACTGTCCCTGCCGGG - Intronic
1154218028 18:12429760-12429782 TGGCCAGGCCTGTCCTGACAGGG + Intronic
1155053225 18:22165703-22165725 TGCGCAGGCCAGGCCCGGCCCGG - Intergenic
1159015689 18:63100176-63100198 ATCCCAGGCCTGTCCCAGCCCGG + Intergenic
1160309271 18:77773460-77773482 TGCCCCTGCCGGTCCTGGCCTGG - Intergenic
1160309327 18:77774466-77774488 TGCCCCTGCCCGTCCTGGCCTGG + Intergenic
1160388855 18:78515143-78515165 AGCCCAGGTCTGTCCTGGCCAGG + Intergenic
1160413150 18:78688413-78688435 TGCCCAGGGCAGACTCGGCCTGG + Intergenic
1160423656 18:78766211-78766233 TGGCCAGGCCGGTCCCACCCAGG - Intergenic
1160507285 18:79434244-79434266 GGCCCAGGCCTACCCCGGCAGGG - Intronic
1160641820 19:145450-145472 TGCCCAGCCCTGTGTCAGCCAGG + Intergenic
1161036370 19:2087139-2087161 TGCCCAGGCCCCTCTGGGCCAGG + Intronic
1161121456 19:2529087-2529109 TGCCCAGGTCTCTCCAGGGCCGG - Intronic
1161221443 19:3119946-3119968 TGCCCAGCCCTCTCTGGGCCTGG + Intronic
1161479130 19:4501927-4501949 CTCCCAGGCCTGTCCAGGTCGGG - Exonic
1161494936 19:4581536-4581558 TGCGCGCACCTGTCCCGGCCGGG + Intergenic
1161707522 19:5829135-5829157 GCCCCAGGCCTCTCCCCGCCGGG - Intergenic
1162555727 19:11384310-11384332 TGACCAGGCCCTTCCCGACCAGG + Exonic
1162959408 19:14117356-14117378 TGCCCCGGCCTGTCCAAGGCTGG - Intronic
1163556617 19:17997044-17997066 CACCCAGGACTGTCCCTGCCTGG + Intronic
1163761208 19:19137751-19137773 TGCCCAGGCCGGTCCCGTCAGGG + Intronic
1164210464 19:23093572-23093594 CCCCCAGCCCTGTCCCAGCCCGG - Intronic
1164875873 19:31688006-31688028 ACCCCAGGCCTGCACCGGCCAGG + Intergenic
1165304709 19:34996283-34996305 TGCCCAGGTCTGACCTGTCCTGG - Intronic
1166295690 19:41888195-41888217 TCCCCAGGCCCCTCCCGGCCTGG + Exonic
1166566594 19:43769341-43769363 TGTCCATGCCTGTCCAGGTCAGG - Intronic
1166697264 19:44859190-44859212 TGCCCTGGCCTTTCCTGGCCTGG + Intronic
1166943661 19:46384057-46384079 GGCCCAGGCCTGTCCGAGCCTGG - Intronic
1166954152 19:46451443-46451465 TGCCCAGGCCTGGATCGGCAGGG - Intergenic
1167073224 19:47232560-47232582 TGCCCAGGCATGTCCATGCCAGG - Exonic
1167502194 19:49854590-49854612 TGCCCTGGCCTGTCCCCGCAGGG - Intronic
1167538494 19:50070725-50070747 TGCCCTGGACTGGCCTGGCCTGG + Intergenic
1168346599 19:55652947-55652969 TGCCCAGCCCTGTCCTCGCCGGG + Exonic
925090993 2:1155982-1156004 TGTCCTGGCCTGGCCTGGCCTGG - Intronic
925147229 2:1589220-1589242 TGCCCAGGTCTGCGCAGGCCTGG - Intergenic
925982842 2:9191166-9191188 TCCACAGGTCTGGCCCGGCCAGG + Intergenic
926692504 2:15747312-15747334 TCCCCATGCCTTTCCCGCCCTGG - Intergenic
927652497 2:24920625-24920647 AGCCCTGGCCTCTGCCGGCCCGG - Intergenic
928242952 2:29602322-29602344 TCCCCAGGCCTGACCCTGCTGGG - Intronic
929511376 2:42568494-42568516 TCCCCGGGCCTCCCCCGGCCCGG + Intronic
930117522 2:47731188-47731210 TGGCCAGGCTTGGCCAGGCCAGG + Intronic
930652585 2:53977333-53977355 TTCCCAGGCCTGGCCAGGCGCGG - Intronic
932739958 2:74283674-74283696 TGCCCAGGTCTGTCTCTGCATGG - Intronic
934146657 2:89101382-89101404 TGCCCAAAAATGTCCCGGCCTGG + Intergenic
934222610 2:90099210-90099232 TGCCCAAAAATGTCCCGGCCTGG - Intergenic
934663469 2:96155150-96155172 TGCCCAGCCTTGCCCTGGCCAGG + Intergenic
935832069 2:107010700-107010722 TGCCCAGCCCTGCTCCAGCCAGG - Intergenic
936522501 2:113220054-113220076 TGCCCAGGCCTCTGCTGGGCAGG - Intronic
937853452 2:126656203-126656225 CGGCCCGGCCTGGCCCGGCCTGG + Exonic
937853453 2:126656206-126656228 TGGCCAGGCCGGGCCAGGCCGGG - Exonic
937917595 2:127106622-127106644 GGCCCTGTCCTGCCCCGGCCGGG + Intronic
939630798 2:144524327-144524349 CCCCCAGACCTGTCCCCGCCCGG + Intronic
946402122 2:219473652-219473674 AGCCCAGGTCTGGCCCAGCCTGG + Intronic
947528528 2:230894064-230894086 TCCCCAGGCCTCCCCAGGCCAGG + Intergenic
947839829 2:233200580-233200602 TTCCCAGGCCTGACCTGGCAGGG + Intronic
947860587 2:233354759-233354781 CGCCCAGGCCCGGCTCGGCCCGG + Intronic
947958555 2:234215410-234215432 TGTCCAGCTGTGTCCCGGCCAGG + Intergenic
948124752 2:235556394-235556416 GGCCCAGGCCAGTCTCGTCCAGG + Intronic
948807974 2:240461113-240461135 CGCCCTGGCCTGTCCCGGAAAGG - Intronic
948879657 2:240850366-240850388 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879672 2:240850410-240850432 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879687 2:240850454-240850476 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879702 2:240850498-240850520 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
1171420398 20:25013857-25013879 TGCCCAGGTCTGTACCTGGCAGG - Intronic
1172248953 20:33465562-33465584 AGCCCTGGCCTGTCCCACCCCGG - Intergenic
1172304421 20:33871152-33871174 AGCCCTGGCCTGTCACTGCCAGG + Intergenic
1172859190 20:38033909-38033931 GGCCCAGGCCGCTCCCTGCCGGG + Exonic
1173122682 20:40308098-40308120 TGCCCAGGCCCGGCGAGGCCTGG - Intergenic
1173162742 20:40664386-40664408 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
1173322391 20:41999419-41999441 TGTCCCGCCCCGTCCCGGCCCGG - Intergenic
1174388413 20:50200813-50200835 TGGCCACCCCTGTCCCTGCCAGG - Intergenic
1174405284 20:50298919-50298941 AGCCCAGGCCTCTGCCTGCCGGG - Intergenic
1175923800 20:62462330-62462352 CTCCCAGGCCTCTCCAGGCCAGG - Intergenic
1175994354 20:62805430-62805452 CTCCCAGGCCAGACCCGGCCCGG - Intronic
1176167575 20:63682083-63682105 GGCCCGGGCCTGTCCCTCCCTGG + Intronic
1176221144 20:63969838-63969860 CGCCCCGGCCCGGCCCGGCCCGG - Intronic
1176299270 21:5090934-5090956 GGCACAGGCCTGGCCTGGCCCGG - Intergenic
1176372202 21:6068909-6068931 AGCCCAGGCCTGCCACGGCGGGG - Intergenic
1176868761 21:14071191-14071213 GGTCCTGGCCTGCCCCGGCCTGG - Intergenic
1178133643 21:29601537-29601559 AGCCCAGGCCTGTTCCAGCTGGG - Intronic
1179542299 21:42091381-42091403 TGCCCAGGTCTGTCCCTGTTGGG + Intronic
1179751317 21:43469630-43469652 AGCCCAGGCCTGCCACGGCGGGG + Intergenic
1179857756 21:44171013-44171035 GGCACAGGCCTGGCCTGGCCCGG + Intergenic
1179885700 21:44313400-44313422 AGCCCAGGCCTGGCCAGCCCAGG - Intronic
1180142556 21:45901143-45901165 GGACCAGGCCTGCCCCCGCCAGG - Intronic
1180354813 22:11829699-11829721 TGCCAGACCCTGTCCCGGCCCGG - Intergenic
1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG + Intergenic
1181030035 22:20145275-20145297 TCCCCGGGCCTGGCCCGGCTGGG + Intronic
1182013614 22:27020936-27020958 AGGCCCGGCCTGTCCTGGCCGGG - Intergenic
1182519190 22:30875864-30875886 TGCCCAGGCCTGTGCCAGGCAGG + Intronic
1183112349 22:35659671-35659693 TGCCGAGGTCTGTCCAGGACAGG - Exonic
1184089226 22:42283674-42283696 TGCCCAGCCCTGCCCTGGCCCGG + Intronic
1184149282 22:42629062-42629084 TGACCAGGCCTCTCCTGGCTTGG - Intronic
1184246588 22:43238792-43238814 TGCCCCTGCCTGTACTGGCCTGG - Intronic
1184254609 22:43280029-43280051 GGCTCAGGCCTGGCCCAGCCTGG - Intronic
1184607661 22:45583303-45583325 TGGCCAGACTTGCCCCGGCCAGG - Intronic
1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG + Intergenic
1185098248 22:48823140-48823162 TGCCCAGGCCTTACCAGTCCTGG - Intronic
1185157318 22:49201839-49201861 TGCCCCAGCCAGTCCAGGCCTGG + Intergenic
1185320757 22:50199357-50199379 TGGCCAGGCCTGTCCCGCTCAGG + Exonic
1185362208 22:50415041-50415063 CGTCCAGGCCTGTGCCTGCCAGG + Intronic
950030115 3:9846586-9846608 TTCCCAGGCCAGGCCAGGCCAGG + Intronic
950097417 3:10338122-10338144 TCCCCTGGCCCGCCCCGGCCAGG + Intronic
950097423 3:10338130-10338152 GGCCCAGGCCTGGCCGGGGCGGG - Intronic
950657382 3:14444987-14445009 TCCCCAGGCCTGCCCAGGGCAGG - Intronic
951187477 3:19730505-19730527 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
952960105 3:38583630-38583652 TGGCCTGTCCTGTCCTGGCCTGG + Intronic
953773068 3:45793577-45793599 TCCCCAGGCCAGGCCCGGCCCGG - Intronic
953882742 3:46700126-46700148 TCCCCAGGCATGCCCTGGCCAGG - Intergenic
954068311 3:48124632-48124654 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
954186210 3:48918938-48918960 TGGCCCGGCCTGACCCGGTCTGG + Exonic
954794129 3:53152961-53152983 TGCCCAGGCCTACCCTAGCCTGG + Intergenic
958641488 3:96813355-96813377 AGCCCAGCCTTCTCCCGGCCTGG - Intergenic
959632129 3:108518623-108518645 TCCCCAGGCCTGACCTGGCTGGG + Intronic
961831961 3:129627472-129627494 TGCCCAGTCCTCTTCCGGACAGG - Intergenic
962314539 3:134350924-134350946 AGCCCAGGGCTGTCAGGGCCAGG + Intergenic
963483290 3:145904034-145904056 AGCCCAGGGCTGTCACAGCCTGG + Intergenic
963733243 3:148992036-148992058 TGCCCCGGCCTCTGGCGGCCCGG + Intronic
964720420 3:159763960-159763982 CGCCCCGGCCCGGCCCGGCCCGG - Intronic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
967859798 3:194141876-194141898 TGCCCACTCCTGCCCCGGCGTGG - Intergenic
968518179 4:1023528-1023550 TGTCCAGGGCTGTCCCGGCTGGG + Intronic
968576379 4:1368113-1368135 TGCGCAGGCCTGTCCTGACCTGG + Intronic
968650523 4:1758545-1758567 TGCCCAGGCCTGTCCGGGTTGGG - Intergenic
968846593 4:3045896-3045918 TGACCTGTCCTGTCACGGCCAGG + Intergenic
968897909 4:3415559-3415581 CGCCTTGGCCTGGCCCGGCCTGG + Intronic
969406529 4:6996709-6996731 CCCCCAGGGCTGTCCCGGGCGGG + Intronic
969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG + Intronic
969695922 4:8734828-8734850 AGCCCTGGCCTGGCCAGGCCAGG - Intergenic
969737329 4:9000554-9000576 TGGCCAGACCAGTTCCGGCCAGG - Intergenic
969796535 4:9532142-9532164 TGGCCAGGCCCGCTCCGGCCAGG - Intergenic
971349550 4:25843822-25843844 TTGCCAGGCCAGACCCGGCCAGG - Intronic
984764367 4:183388259-183388281 TGACCTGGCCTGACCTGGCCTGG + Intergenic
984815279 4:183830573-183830595 TGCCCAGGGCTGGTCTGGCCTGG + Intergenic
985953101 5:3238186-3238208 TGCCCAGTCCTGTGCTGGCTGGG - Intergenic
987054867 5:14181811-14181833 TGGCCACGCCCCTCCCGGCCTGG + Intronic
991584486 5:68187995-68188017 TGCCCAGGCCCGGCGAGGCCGGG + Intergenic
992546580 5:77819654-77819676 TCCCCAGCCCTGTCCATGCCTGG - Intronic
993048052 5:82891421-82891443 TGCCCAGGCCTCTCCTGGACTGG + Intergenic
993401132 5:87452985-87453007 TGCCAAGCCCTGTCCTGTCCAGG + Intergenic
994679386 5:102866157-102866179 TGCCCGGTCCTCTCCCGGCGGGG + Exonic
994744774 5:103664798-103664820 TCCCCAACCCTGTCCTGGCCTGG + Intergenic
996693795 5:126370269-126370291 AGCACAGACCTGTCCCTGCCAGG + Intronic
997203067 5:132024372-132024394 AGCCCAGGCTGGTCCCGGGCTGG - Intergenic
997469194 5:134107343-134107365 TGGCCAGCCATGGCCCGGCCGGG - Intergenic
997511532 5:134458073-134458095 TGCCAAGGCCTGTGCCGGATAGG + Intergenic
998225643 5:140324376-140324398 TGCCCACCCCTGTCCCAGCTGGG - Intergenic
999114211 5:149148357-149148379 AGCCCAGGCCTTTCCAAGCCTGG - Intronic
1001605742 5:172958758-172958780 TGCCCGTGCCTGGCCCCGCCGGG - Intronic
1002735040 5:181379034-181379056 TGCCCAGCCCTGTGTCAGCCAGG - Intergenic
1002749486 6:95088-95110 TGCCCAGCCCTGTGTCAGCCAGG + Intergenic
1003840381 6:10113391-10113413 TGCGCAGGCCTGGCCCAGCGGGG + Intronic
1005998257 6:30945339-30945361 TGGCCTGGCCTGGCCTGGCCTGG - Intronic
1006981560 6:38152009-38152031 TGCTCAAGCCTGTCCCTGCCTGG - Intronic
1006985134 6:38170875-38170897 TGCCCAGGTCGGGCACGGCCCGG - Exonic
1007016266 6:38470310-38470332 TACACAGGCCTGTACTGGCCAGG - Intronic
1007391349 6:41551296-41551318 GGCCCAGGCATGTCCAGCCCGGG - Intronic
1011464285 6:87639572-87639594 CTCCCAGGCCTGACCCAGCCTGG + Intronic
1014657899 6:124130956-124130978 TGCGCAGTCCTGTCTTGGCCTGG + Intronic
1017914071 6:158818692-158818714 TCCCCGGGCCTTTCCCCGCCGGG - Intronic
1018134288 6:160764583-160764605 TGCTCTGGCCTGGCCTGGCCTGG - Intergenic
1018724309 6:166598944-166598966 TGCCCAGGCAGGGCCCAGCCCGG + Intronic
1019164475 6:170088843-170088865 GGCCCTGGACTGTCCCCGCCGGG + Intergenic
1019172012 6:170138039-170138061 TTACCAGGCCTCGCCCGGCCCGG + Intergenic
1019201850 6:170323177-170323199 TGACCAGGCCTTACCCAGCCAGG + Exonic
1019239299 6:170651351-170651373 TGCCCAGCCCTGTGTCAGCCAGG - Intergenic
1019279486 7:192811-192833 CGCCCAGGCCCGTCGCGCCCCGG + Intergenic
1019299412 7:295895-295917 AGCCCAGCCCTGTCACAGCCTGG - Intergenic
1019307382 7:342278-342300 TGGCCAGGCCTGGCCAGACCGGG + Intergenic
1019705537 7:2495651-2495673 GGCCCAGCCCTGTGCCTGCCCGG + Intergenic
1019779866 7:2932987-2933009 TGCCCTGGCCACCCCCGGCCCGG + Intronic
1019978454 7:4603252-4603274 TGCCCAGGCCGGCCTCCGCCGGG + Intergenic
1020083162 7:5297123-5297145 TGCCCAGGCCTGGCCTGCCCCGG - Exonic
1020101652 7:5397350-5397372 GGCCCAGGCCGGCCCCTGCCCGG + Intronic
1020107805 7:5430226-5430248 TGCACAGGCCTGCCCCGGAGGGG - Intergenic
1022207566 7:28179682-28179704 TGCCCTCCCCTGCCCCGGCCTGG - Intronic
1023861448 7:44219768-44219790 TGCCCAGGACTGTGCTGCCCGGG + Intronic
1023874940 7:44281843-44281865 TGCCCACTGCTCTCCCGGCCAGG + Intronic
1023912764 7:44567241-44567263 TGCCCAGGCTTTTCCTGCCCTGG + Intronic
1024208197 7:47181757-47181779 TGCTCAGCCCTGTCCCAGCCCGG + Intergenic
1025098673 7:56117048-56117070 TGCCCAGGCCAGTTTCGTCCTGG + Intergenic
1025211121 7:57020064-57020086 TGCCCAGGCCTGGCCTGCCCCGG + Intergenic
1025261977 7:57425835-57425857 TCCCCGGGCCTGTCCCCGTCTGG + Intergenic
1025615471 7:63113450-63113472 TCCCCAGGCCTGCCCCCGGCTGG - Intergenic
1025660834 7:63556783-63556805 TGCCCAGGCCTGGCCTGCCCCGG - Intergenic
1025739302 7:64183052-64183074 TCCCCAGGCCTGTCCCCGGCTGG + Intronic
1026149006 7:67772358-67772380 TGCCCGCACCTGTCCTGGCCAGG + Intergenic
1026605234 7:71810286-71810308 TGCATTGGCCTGTCCCGGACCGG + Intronic
1026865737 7:73823001-73823023 TGACAAGACCTGTCCTGGCCTGG + Intronic
1030262523 7:107580388-107580410 TGGCCTGGCCCGACCCGGCCCGG + Intronic
1032491803 7:132329449-132329471 TGCTCAGCCCTGTGCCTGCCAGG + Intronic
1033654270 7:143362540-143362562 GGCCCAGCCCTGCCCCCGCCCGG + Intronic
1034343494 7:150372201-150372223 GGCCCAGGCCGCCCCCGGCCCGG + Exonic
1035508471 8:155257-155279 TGCCCAGCCCTGTGTCAGCCAGG + Intergenic
1035649308 8:1253078-1253100 CGCCCGGGCCTGTCCCCGCGTGG + Intergenic
1036609206 8:10335037-10335059 TGCCCAGGCCTCTACCTGCACGG - Intronic
1038459205 8:27702382-27702404 TGCCCAGTCCTGGCACTGCCTGG + Intergenic
1039442909 8:37607853-37607875 AGCCCAGGCCTGGCAGGGCCAGG + Intergenic
1039518007 8:38148971-38148993 TGGTCAGGCCTGGCCCTGCCTGG + Intronic
1040039025 8:42897387-42897409 TTCCCAGCCCAGCCCCGGCCGGG - Intronic
1040286832 8:46104774-46104796 CACCCAGGGCTGTCCCGGGCGGG - Intergenic
1040288763 8:46113694-46113716 TCCCCAGGTCTGTCCTGGGCGGG - Intergenic
1040291427 8:46127543-46127565 CCCCCAGGTGTGTCCCGGCCTGG - Intergenic
1040292419 8:46132248-46132270 CCCCCAGGGCTGTCCTGGCCTGG - Intergenic
1040293240 8:46136150-46136172 TCCCCTGGGCTGTCCCGGGCGGG - Intergenic
1040295096 8:46144941-46144963 CGCCCAGGCCTGTTTCGGTCAGG - Intergenic
1040295829 8:46148591-46148613 TCCCCAGGGCTGTCCTGGTCGGG - Intergenic
1040303875 8:46202127-46202149 TCCACAGGGCTGTCCCGGGCGGG + Intergenic
1040304382 8:46204496-46204518 TCCCCAGGGCTGTCCCGGGAAGG + Intergenic
1040304573 8:46205372-46205394 CACCCAGGTCTGTCCCGGACGGG + Intergenic
1040305423 8:46209396-46209418 CCCCCAGGACTGTCCCGGACAGG + Intergenic
1040307034 8:46217449-46217471 TCCCCAGGACTGTCCTGGGCAGG + Intergenic
1040307783 8:46221140-46221162 TCCCCAGGGCTGTCTCGGGCTGG + Intergenic
1040308410 8:46224076-46224098 CACCCAGGGCTGTCCCGGCCTGG + Intergenic
1040311009 8:46236861-46236883 CCCCCAGGACTGTCCCGGGCCGG + Intergenic
1040311866 8:46240948-46240970 CCCCCAGGTCTGTCCCGGGCGGG + Intergenic
1040312387 8:46243518-46243540 CACCCAGGGCTGTCCCGGGCGGG + Intergenic
1040312760 8:46245238-46245260 CCCCCAGGGCTGTCCCGGGCGGG + Intergenic
1040312935 8:46246127-46246149 TCCCCAGGGCTGTCCTGGGCAGG + Intergenic
1040314608 8:46254387-46254409 TTCCCAGGGCTGTCCTGGACGGG + Intergenic
1040315127 8:46256973-46256995 CCCCCAGGGCTGTCCCGGGCGGG + Intergenic
1040325134 8:46337827-46337849 CCCCCAGGTCTGTCCCGGGCAGG + Intergenic
1040330434 8:46383079-46383101 TCCTCAGGCCTGTCCCAGGCAGG + Intergenic
1040335637 8:46414600-46414622 CCCCCAGGTCTGTCCCGGGCAGG + Intergenic
1040336530 8:46418872-46418894 CCCCCAGGGCTGTCCCGGGCTGG + Intergenic
1040337474 8:46423376-46423398 TTCCCAGGGCTGTCCCGGGCAGG + Intergenic
1040338606 8:46428630-46428652 CCCCCAGGGCTGTCCCGGGCAGG + Intergenic
1040338921 8:46430108-46430130 CCCCCAGGGCTGTCCCGGGCGGG + Intergenic
1040340617 8:46438687-46438709 ATCCCAGGGCTGTCCCGGGCAGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1042235878 8:66613054-66613076 AGCCCCGGCCCGGCCCGGCCAGG + Exonic
1044992051 8:97804794-97804816 TGGCCTGGCCTGGCCTGGCCTGG + Intronic
1044992053 8:97804799-97804821 TGGCCTGGCCTGGCCTGGCCTGG + Intronic
1048872990 8:138814107-138814129 TGCCAGGGCCTGGCCCTGCCTGG + Intronic
1048974326 8:139662579-139662601 AGCCTAGGCCTGTCCAGTCCAGG - Intronic
1049024148 8:139977206-139977228 TACCCAGCCCTGTCCCGCACGGG - Intronic
1049364699 8:142231503-142231525 TGCAGAGCCCTGTCCCTGCCAGG - Intronic
1049580191 8:143407533-143407555 TGCCCGGGGCTGCCCCGACCTGG - Intergenic
1049621270 8:143599368-143599390 TGCCCAGCACTGTCCTCGCCGGG - Exonic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1050343221 9:4662008-4662030 TGCCCAGGAGTGTTCCTGCCTGG - Exonic
1052375747 9:27715959-27715981 TGCCCACGCCTGTTCCTCCCAGG - Intergenic
1053067638 9:35079598-35079620 TGCCCAGGCCCCTCCCCGCTGGG - Exonic
1053223164 9:36328130-36328152 TCCTCTGGCCTGTCCCTGCCAGG + Intergenic
1057196452 9:93118144-93118166 GGCCCAGGCCTGGTACGGCCAGG - Intergenic
1057229234 9:93308807-93308829 AGCCCTGGCCTGGCCTGGCCTGG - Intronic
1057259691 9:93576712-93576734 TGCCCGGGTCGGTCCGGGCCGGG - Exonic
1058866507 9:109166718-109166740 TGCCCAGGCCTCCGCCGGCCTGG - Intronic
1059339252 9:113588131-113588153 TGCCCAGGCCAGTCCCCTGCAGG - Intronic
1060545034 9:124454506-124454528 TGCCCAGTCGTGGCCTGGCCAGG + Exonic
1060932053 9:127495427-127495449 TGCTGGTGCCTGTCCCGGCCAGG + Intronic
1061482242 9:130902991-130903013 GACCCAGGCCAGGCCCGGCCCGG - Exonic
1061488845 9:130934194-130934216 TGCCCAGCCATGTGCCAGCCGGG - Intronic
1062334322 9:136058348-136058370 GGCCCAGGCCCTTCCCAGCCAGG + Intronic
1062341379 9:136095198-136095220 TGCCCAGGCCGGACCGGGCCGGG - Exonic
1062364615 9:136202880-136202902 TCCTCAGGCCTTTCCGGGCCTGG - Intronic
1062502778 9:136858440-136858462 CGCCCAGGCCGGGCCAGGCCAGG - Exonic
1062504437 9:136865968-136865990 TTCCCACCCCTGTCCTGGCCCGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062546125 9:137064481-137064503 TCCCCAGGCCTGCCCCCGGCTGG - Exonic
1062573946 9:137197956-137197978 TGCCAAGGCCAATCCCGGGCAGG + Intronic
1062657869 9:137613518-137613540 TCACCAGGCCTGTCCAGGCTGGG - Intronic
1062759507 9:138331642-138331664 TGCCCAGCCCTGTGTCAGCCAGG - Intergenic
1203599954 Un_KI270748v1:2414-2436 TGCCCAGCCCTGTGTCAGCCAGG - Intergenic
1186077543 X:5897603-5897625 TGCCCAGGCCTGTGCCTGAGGGG - Intronic
1187400376 X:18954316-18954338 TGCCCAGGCCCCACACGGCCAGG + Exonic
1190743028 X:53302860-53302882 TGCCCAGGCTGGTCTCGACCTGG - Intronic
1192528961 X:71870321-71870343 TGTCCATCCCTGCCCCGGCCAGG + Intergenic
1195716959 X:107826724-107826746 TGCCCGCGCCGGGCCCGGCCAGG - Intronic
1196442225 X:115727976-115727998 AGGCCAGGCCCGGCCCGGCCCGG - Intergenic
1196443332 X:115732928-115732950 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196444190 X:115737009-115737031 AGGCCAGGCCCGGCCCGGCCCGG - Intergenic
1196445653 X:115844843-115844865 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196446324 X:115847824-115847846 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196446995 X:115850805-115850827 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196447664 X:115853788-115853810 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196448334 X:115856767-115856789 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196449003 X:115859758-115859780 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196449674 X:115862749-115862771 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196450343 X:115865732-115865754 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196451013 X:115868717-115868739 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196451684 X:115871696-115871718 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196452355 X:115874683-115874705 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196453025 X:115877652-115877674 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196453695 X:115880645-115880667 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196454364 X:115883654-115883676 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1196455444 X:115888726-115888748 AGGCCAGGCCCGGCCCGGCCCGG + Intergenic
1200034583 X:153319300-153319322 TGCCCAGGCCTCCCCGGCCCAGG - Intergenic
1200039227 X:153353721-153353743 AGCCAATGCCTGCCCCGGCCTGG + Intronic
1200045198 X:153397271-153397293 TGCCCAGGCCTCCCCAGCCCAGG - Intergenic
1200163272 X:154019824-154019846 GGCCCCGGCAGGTCCCGGCCCGG - Exonic
1200248018 X:154536086-154536108 GGACCAGGCCTGTCCCTGGCGGG + Intronic
1201517769 Y:14836106-14836128 TGCCCAGGCCTGTGCCTGAGGGG + Intronic