ID: 1119545590

View in Genome Browser
Species Human (GRCh38)
Location 14:75469331-75469353
Sequence CCTGCTTCAGCTCCTCAATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119545590 Original CRISPR CCTGCTTCAGCTCCTCAATC TGG (reversed) Exonic
901206241 1:7497409-7497431 CCTGGCTCTGCTCCTCACTCTGG + Intronic
902886377 1:19407782-19407804 CCGGGGTCAGCTCCTCATTCAGG + Intronic
903034238 1:20484531-20484553 CCCGCTTCAGCTCCCCTCTCGGG + Intronic
903390214 1:22958745-22958767 CCTGCTCCAGCCCGTCCATCAGG + Exonic
904351237 1:29908147-29908169 CCTGCCTTAGGTCCTCAATCGGG - Intergenic
904897106 1:33825347-33825369 CCTCCTTCAGCTCCTCTTTTAGG - Intronic
905826290 1:41028205-41028227 CCTGCTTCAGCCGGTCAATGTGG + Exonic
906671109 1:47655689-47655711 CCTGCTGGAGCTCCTCCAGCTGG + Intergenic
908776786 1:67648360-67648382 ACTGCCTCAGCTCCCCAAGCTGG - Intergenic
909145389 1:71923771-71923793 CCTTCTTCAGCACATCAATCTGG + Intronic
909888946 1:80978750-80978772 CTTGCTGCAGCTTCTCTATCAGG + Intergenic
912491394 1:110064670-110064692 CCTTCTCCAGCTCCTCCAGCTGG + Exonic
912850329 1:113118633-113118655 GCTGTTTCTGCTCCTCACTCTGG + Intronic
913590381 1:120319239-120319261 CCTGCTGTCGCTCCTCAAACTGG - Intergenic
913617805 1:120579124-120579146 CCTGCTGTCGCTCCTCAAACTGG + Intergenic
914572466 1:148931848-148931870 CCTGCTGTCGCTCCTCAAACTGG - Exonic
914600373 1:149198414-149198436 CCTGCTGTCGCTCCTCAAACTGG + Intergenic
914878100 1:151527086-151527108 CCTTCTTGAGCACCTCAACCTGG - Exonic
917939298 1:179902135-179902157 CCTGCCTCAGCCCCCCAAGCAGG + Intronic
919351447 1:196459883-196459905 CTTGCTTCAGGTCCCAAATCAGG + Intronic
920524561 1:206657187-206657209 CCTGGATCTGCTCCTCAATCAGG - Intronic
922909883 1:229206456-229206478 CCTTCTTCAGCTCATCAAGGTGG - Intergenic
924762599 1:247002669-247002691 CCTGCTTCAGCTTCCCAAGCTGG - Intronic
924802447 1:247337416-247337438 CCTCCTTCTCCTCCTCCATCCGG - Intergenic
1066659966 10:37728927-37728949 CCTGCTTCTCCTCCTCTAGCTGG - Intergenic
1067363704 10:45605227-45605249 CCTGCCCCAGTTCCACAATCAGG + Intergenic
1070747937 10:78946108-78946130 CCTGCTTCAGCTCCTGTTTCTGG + Intergenic
1070825536 10:79388368-79388390 CCTCCAACAGCTCCTCCATCTGG + Intronic
1072225100 10:93361409-93361431 CCTGCTGCAGAGCCCCAATCAGG + Intronic
1072497745 10:95979367-95979389 CCTGGTTCAGTTCCTCATTATGG + Intronic
1074161030 10:110836480-110836502 CCTGACTCAGCTCCTCATGCAGG - Exonic
1076217057 10:128703592-128703614 CCTGCTTCAGCACCTCTTTGGGG + Intergenic
1076537399 10:131188806-131188828 TCTGCCTCCGCTCCTAAATCTGG + Intronic
1076564017 10:131386165-131386187 CCTCCTTCAGCTCCTCCCTCTGG - Intergenic
1076745016 10:132508552-132508574 CCTGCTGCTGCTCCTAAATGGGG + Intergenic
1076824954 10:132962240-132962262 CCTGCTTTAACTAGTCAATCCGG - Intergenic
1076907506 10:133370632-133370654 CCTGGTTGAGCTCGTCAATCAGG + Exonic
1077630524 11:3808441-3808463 CCTGGCTCTCCTCCTCAATCTGG - Exonic
1079293441 11:19209828-19209850 CCTCCTTCACCTCCTCCCTCTGG + Intronic
1080233620 11:30045163-30045185 CCTGTCTCAGCTGCTTAATCTGG - Intergenic
1080854164 11:36097385-36097407 CCTGCCTCAGCTACTCCTTCTGG + Intronic
1081568507 11:44275431-44275453 CCTTCTCCAGCTCCTCCAGCTGG + Exonic
1081990979 11:47337499-47337521 CATGACTCAGCTCCTGAATCAGG + Exonic
1083447167 11:62715830-62715852 TCTCCTTCTGCTCCTCACTCTGG - Intronic
1084160292 11:67345109-67345131 CCTGCCTCAGCCCCACTATCTGG + Intronic
1084309771 11:68310221-68310243 ACCTCTTCAGCTCCTCAGTCAGG - Intergenic
1084317119 11:68351964-68351986 TCTGCTACAGCCCCTCAAACAGG - Intronic
1084471318 11:69360801-69360823 CCTGCCCCAGCCCCTCATTCAGG - Intronic
1084775811 11:71374342-71374364 CCTCCTCCAGCTCCAGAATCAGG + Intergenic
1086109518 11:83184038-83184060 CCTGCCTCAGCCTCACAATCAGG - Intronic
1087137206 11:94732781-94732803 CCTGCTTAAGCTCCTCTTTAGGG + Intronic
1089653375 11:119929890-119929912 CCTCATTCAGCTCATCATTCTGG - Intergenic
1090037520 11:123261749-123261771 CCTTCTTCAGGTCCTCAAGCAGG + Intergenic
1091846040 12:3657013-3657035 CCTGCTTCAGCACCTCTCTGTGG - Intronic
1092248515 12:6877721-6877743 CCTGCTTCAGCCTCTCAAAGTGG - Intronic
1092863021 12:12735833-12735855 CCTGCTTCAGCTTCCCAAGTAGG - Intronic
1092965014 12:13633061-13633083 CCTCCTTCACAGCCTCAATCTGG + Intronic
1094621140 12:32081668-32081690 CCTGCTTCAGCTTCCCAAAGTGG + Intergenic
1096149212 12:49298025-49298047 CCTGCCTCACCTCCCCATTCCGG - Exonic
1096578574 12:52569966-52569988 CCAGCTGCAGCTCCTGGATCTGG + Exonic
1096593643 12:52679847-52679869 CCTTCTTCAGCCCCTCAATGTGG - Exonic
1096692684 12:53330759-53330781 GCTGCTTCAGCTCCTGACTAAGG + Intronic
1098240995 12:68466983-68467005 CCTGTTTCATCTCCTCAAGGAGG - Intergenic
1100866239 12:98860290-98860312 CCTGTGTCAGCTCTTCAAACTGG + Intronic
1102856157 12:116295892-116295914 CCTGCTTCAGCTCCTCCTGTTGG - Intergenic
1103938104 12:124487036-124487058 CAAGCTTCAGCTCCTCAGGCTGG - Intronic
1104512103 12:129390303-129390325 CCTGCCTCAGCTACTCAACTGGG - Intronic
1107326925 13:39254220-39254242 CCTGCTTCAGCTCTAAACTCTGG + Intergenic
1107514480 13:41115753-41115775 CCTGCCTCAGCTCCCCAAGTAGG + Intergenic
1107609936 13:42103023-42103045 CCTGCTGCTTCTCTTCAATCAGG - Intronic
1107882592 13:44845602-44845624 CCTGCTTCAGCTTCCCAAGTAGG + Intergenic
1108383004 13:49872198-49872220 CCTGCTTCTGCTCCTGAGGCTGG - Intergenic
1108755643 13:53498687-53498709 CCTGCTTCAGCCTCTCAAGTAGG - Intergenic
1109191313 13:59327453-59327475 CCTGCCTCAGCCTCTCAAGCTGG - Intergenic
1111487879 13:88927265-88927287 CCAGCTGCAGCTCCACAACCTGG - Intergenic
1112029915 13:95447622-95447644 CCTGCTTCAGCTCCTTCACCAGG + Intronic
1112447705 13:99480357-99480379 CCTGCCTCAGCCCCTCAAGTAGG - Intergenic
1113103996 13:106752898-106752920 CTTTCTTCAGCTTCTCACTCTGG - Intergenic
1113266768 13:108627374-108627396 CCTCCTTCAACTCCTCAAAGTGG + Intronic
1115521234 14:34234830-34234852 ATTGCTTCACCTCCTCTATCTGG - Intronic
1116443356 14:44980031-44980053 CCAGCTTCAGCTACTAAATAAGG - Intronic
1117328403 14:54689486-54689508 TGTGCTTCAGTTCCTCCATCTGG - Intronic
1117769935 14:59123755-59123777 CCTGCTTCAGATCTCAAATCAGG - Intergenic
1118121766 14:62853681-62853703 TCTGTTTCCGCTCCTCATTCAGG + Intronic
1118463588 14:66010566-66010588 CCTGTTTCAGCTGCTTAGTCCGG + Intergenic
1119383837 14:74245183-74245205 CCTTCTCCAGCTCCTCTAGCTGG - Exonic
1119545590 14:75469331-75469353 CCTGCTTCAGCTCCTCAATCTGG - Exonic
1119607458 14:76032964-76032986 CCACCATCAGCTCCTAAATCAGG - Intronic
1120355028 14:83421591-83421613 GCTGTTTCTGCTCCTCAAACCGG - Intergenic
1121440967 14:93949039-93949061 CCTGCTTCATCTCCTCGGGCAGG + Intronic
1121678079 14:95770612-95770634 CTTGCTTAAGCCACTCAATCTGG + Intergenic
1122084772 14:99291914-99291936 CCTGCTTCCTCTCCTCCTTCAGG + Intergenic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1127269365 15:57386870-57386892 CCTTTTTCAGCTCCTAAATCAGG - Intronic
1127491700 15:59471059-59471081 CCTGCCTCAGCTTCTCAAAGTGG + Intronic
1127774687 15:62255612-62255634 CCAGCTTCAACTCCTCCATCTGG + Intergenic
1128944159 15:71810178-71810200 CCTGCCTCAGCCTCCCAATCAGG - Intronic
1131264031 15:90905274-90905296 GCTGCTCCAGCTGCTCAATGCGG - Exonic
1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG + Intronic
1133422729 16:5660769-5660791 CCTGCTTCAGCTCACCTCTCCGG - Intergenic
1136866933 16:33766648-33766670 ACTGCCTCGGCTCCTCACTCAGG + Intergenic
1137554350 16:49461270-49461292 CCTGCTAAAGCTCCTTCATCAGG - Intergenic
1138358695 16:56407491-56407513 CCTGCCTCAGCTTCCCAAGCAGG + Intronic
1138548620 16:57735121-57735143 CCTGCCTCGGCTCCGGAATCAGG + Intergenic
1138735692 16:59247924-59247946 CCTGCCTCAGCTCCCCAAGTAGG + Intergenic
1139354812 16:66361173-66361195 CCTGCCTGAGCTCCTCAGTGTGG + Intergenic
1139922828 16:70470644-70470666 TCTCCTTTAGCTTCTCAATCAGG - Intronic
1141115091 16:81301613-81301635 CTTGCTTCAGATTCTCAATAGGG + Intergenic
1203105229 16_KI270728v1_random:1349554-1349576 ACTGCCTCGGCTCCTCACTCAGG - Intergenic
1203128285 16_KI270728v1_random:1612814-1612836 ACTGCCTCGGCTCCTCACTCAGG + Intergenic
1143933152 17:10452306-10452328 CCTCCTCCAGCTCCTCAATGCGG + Exonic
1143937446 17:10501475-10501497 CCTCCTCCAGCTCCTCAATGCGG + Exonic
1143939858 17:10529055-10529077 CCTCCTCCAGCTCCTCAATGCGG + Exonic
1144113971 17:12067561-12067583 ACTTCTGCAGCTCCTCAGTCAGG - Intronic
1144370029 17:14581440-14581462 CCTGCTGCAGCTACTCAGTTGGG - Intergenic
1145063199 17:19745003-19745025 CCTGCTCCTGCTCCTGGATCAGG + Exonic
1145253884 17:21312186-21312208 CCTGCTTCAGCTGCTGGAACGGG - Exonic
1145322707 17:21775773-21775795 CCTGCTTCAGCTGCTGGAACGGG + Intergenic
1146171557 17:30638243-30638265 CCTGCCTCAGCTTCTCAAGTAGG + Intergenic
1146345018 17:32054258-32054280 CCTGCCTCAGCTTCTCAAGTAGG + Intergenic
1146694012 17:34895462-34895484 CCTGCTTCACCTCTTCCAACTGG + Intergenic
1147674392 17:42194533-42194555 CCTCCTTCAGCTCCTCCCTCAGG - Intergenic
1147682571 17:42260656-42260678 CCTGCTTTGGCTCCCCAAACTGG + Intronic
1148509470 17:48156427-48156449 CCTGCACCAGCGCCACAATCTGG + Intronic
1149317389 17:55451311-55451333 CCTCCTTCAGCACCTCCAGCTGG + Intergenic
1150947874 17:69766461-69766483 CCTGCCTCAGCCCCTCAAATAGG + Intergenic
1152174133 17:78775588-78775610 CCTGCTTTAGATAATCAATCTGG + Intronic
1152341491 17:79728329-79728351 ACTGCCTCGGCTCCTCACTCAGG + Intergenic
1152419394 17:80183965-80183987 CCTGGTTCAGCTCCTCCTGCAGG - Exonic
1153097164 18:1420056-1420078 ACTGCTTCAGATCCTCAATAGGG - Intergenic
1153626346 18:7025239-7025261 CCTGCTGCAGTTCCTCAAATGGG + Intronic
1155365833 18:25048153-25048175 CCTCCTCCAGCTCCTCTATTGGG - Intergenic
1158461246 18:57648096-57648118 TCTGCTTCAGCTTCTCAAATAGG + Exonic
1158516341 18:58133453-58133475 CCTGTTCCAGCTGCTAAATCTGG - Intronic
1161691379 19:5736600-5736622 CCTGCCTCAGCCTCTCAAGCTGG - Intronic
1161743604 19:6041178-6041200 CCTGCTTCAGCCTCTGAATATGG + Intronic
1162019813 19:7863256-7863278 CGGCCTTCAGCTCCTCGATCTGG - Exonic
1162482697 19:10937849-10937871 CCTGCCTCAGCTTCTCAAAGTGG + Intergenic
1163349054 19:16763914-16763936 CCTGTTTCAGCTCCTCCAGGCGG - Exonic
1163777431 19:19226661-19226683 CCTGCTTCTCCTCCAAAATCAGG - Exonic
1164616439 19:29669351-29669373 CCTGCCTCAGCTACTGAATGTGG + Intronic
1165272053 19:34718325-34718347 CCAGCTTCATCTTCTCACTCAGG - Intergenic
1165351671 19:35279163-35279185 CATTCTTCAGCTCCTCGATCTGG - Exonic
1166793935 19:45414875-45414897 CCTGCTCTAGCTTCTCCATCAGG + Exonic
1167397439 19:49240183-49240205 CTTGCTGCAGCTTCTCCATCAGG + Intergenic
1168351431 19:55678366-55678388 CATGTTTCAGTTCCTCAAACAGG - Intronic
925298260 2:2792504-2792526 TCTGCCCCAGCTCCTCAAGCAGG - Intergenic
925640399 2:5981424-5981446 CCTCCTTCAGCGCCTGAAGCCGG - Intergenic
925765824 2:7234449-7234471 CTTGCCTCAGCTCCCCAAGCTGG + Intergenic
927174804 2:20398405-20398427 CCTGGTTCAGCTCTTCCATCTGG - Intergenic
929065415 2:37968326-37968348 CCTGCCTCAGCCCCCCAAGCTGG - Intronic
929219980 2:39453750-39453772 CCTGCCTCAGCTTCTCAAGTAGG + Intergenic
929851852 2:45598689-45598711 CCTGATTCCACTTCTCAATCTGG - Intronic
929858124 2:45652400-45652422 TCTGCAGCAGCTCCTCAAACTGG - Exonic
931025690 2:58111503-58111525 CCTGCTTCAGCTTCCCAAAATGG - Intronic
932284167 2:70518622-70518644 CCCACTCCAACTCCTCAATCAGG + Intronic
932698021 2:73973210-73973232 CCTGCAGCAGCTCCTCCAACAGG + Intergenic
932822717 2:74915216-74915238 CCTGCATCAGCACCTCCATGAGG - Intergenic
933239471 2:79903772-79903794 CCAGCTTCAGCTCCTGATCCGGG - Intronic
933476399 2:82797465-82797487 TCTGTTTCAGATTCTCAATCAGG + Intergenic
934762349 2:96863726-96863748 ACAGCTGCAGCTCCTCAATCAGG + Exonic
934937137 2:98473558-98473580 CCTGCTTCCCCTCCTTACTCTGG + Intronic
935132750 2:100273194-100273216 CCTCCTTCATCTCCTCCAGCTGG - Intergenic
937781454 2:125843376-125843398 CCTGCTCTGTCTCCTCAATCAGG + Intergenic
944565765 2:200989564-200989586 CCTGCTTCAGCCTCTCAAAGTGG - Intronic
945795818 2:214362308-214362330 ATTGCTTCAGCTCCTCAATGTGG - Intronic
947893275 2:233644984-233645006 TCTAATTCAGCTTCTCAATCAGG - Intronic
948482872 2:238261478-238261500 CGTCCTTCAGCTACTCACTCAGG + Intronic
1172448030 20:35003257-35003279 CCTGCATCAGCTTCTCATACTGG - Exonic
1172870217 20:38131100-38131122 CCGTCTTCTGCTCCTCAGTCAGG + Exonic
1173143542 20:40505686-40505708 CCTTCCTCAGCTCCTCAGTGAGG - Intergenic
1174819975 20:53718210-53718232 CCTGCTTCAGATCACTAATCTGG + Intergenic
1175394088 20:58646852-58646874 GCTGTTTCAGGGCCTCAATCAGG + Intergenic
1175402740 20:58709826-58709848 CCTGCTTGCCCTCCTTAATCTGG - Intronic
1176284465 21:5012252-5012274 TCTGCGTCAGCTCCTCCCTCGGG + Intergenic
1177611527 21:23455575-23455597 CATGTTTCAGCTCCTCCACCTGG + Intergenic
1179541718 21:42087245-42087267 CCTGCTTCTGCTGCTGAATAAGG + Intronic
1179872716 21:44251223-44251245 TCTGCGTCAGCTCCTCCCTCGGG - Intronic
1179893234 21:44348215-44348237 CCTGCTCCCGCGCCTCACTCAGG + Intergenic
1182057639 22:27372476-27372498 GCTGCTTCAGCTCCTCTCTGGGG - Intergenic
1183252092 22:36737410-36737432 TCTGCTTCTCCTCCTCAAACTGG - Intergenic
1184233691 22:43171818-43171840 CCTGCTTCAGCACCACATCCGGG + Exonic
1184387305 22:44183353-44183375 CCTGCTGCAGCTCCCCAAGGGGG + Exonic
1185365806 22:50436223-50436245 CCTGCTTCAGGCCCTCAGACGGG + Intronic
949537354 3:5006235-5006257 AAGGGTTCAGCTCCTCAATCAGG - Intergenic
949627349 3:5881732-5881754 GCTGCTTTAGCTCCTCAATCAGG - Intergenic
949965071 3:9348955-9348977 CCTGCTTCCCCTCCTTGATCTGG - Intronic
950199635 3:11034096-11034118 CCTGCTTCAGCTCCTGCTTGTGG - Intronic
952702547 3:36342011-36342033 CCTTCTTCATGCCCTCAATCAGG + Intergenic
954291604 3:49652868-49652890 CCTGCCTCAGCTCCTCCGTCGGG - Exonic
956148497 3:66216398-66216420 CCTGCCTCAGCTCCTCAAGTAGG - Intronic
963005399 3:140722345-140722367 CCTGCTTTAGCTCCTACAGCTGG - Intergenic
964229159 3:154442786-154442808 TCTGCTTCAGTTCCTCTGTCTGG - Intergenic
965225154 3:165979524-165979546 CCTGCTTCAGCCTCCCAATTAGG + Intergenic
966240720 3:177752823-177752845 CCTGCTTTTGCTCCTTAGTCTGG + Intergenic
972327937 4:38035677-38035699 CCTGCTTCATCTCCCCAATATGG - Exonic
975145717 4:70965183-70965205 CCTGCTTCAGCCTCCCAAGCAGG - Intronic
979606683 4:122645827-122645849 CCTCCTTCAGCTTCTCCATATGG + Intergenic
981125589 4:141102614-141102636 CCTGCTTCCCTTGCTCAATCAGG + Intronic
981960403 4:150530715-150530737 CCTGTTTCAGCATCTCAACCTGG + Intronic
985521222 5:374716-374738 GCTGCCTCACCTCCTCACTCGGG + Intronic
985812256 5:2098802-2098824 CCTGTGTCAGCTCCACAGTCTGG + Intergenic
986451554 5:7869725-7869747 CCTGCTACTGCCCCACAATCCGG - Intronic
986858853 5:11903864-11903886 CCGGCGACAGCTCCTCAGTCCGG + Exonic
987531242 5:19122794-19122816 CCTCATTCAAGTCCTCAATCAGG + Intergenic
988194885 5:27992423-27992445 GCTGCTTCACATCTTCAATCAGG - Intergenic
992702715 5:79357153-79357175 CCTGCTTCAGCCTCTCAAATAGG + Intergenic
996385438 5:122905394-122905416 CCTGCCTCAGCCACTCACTCAGG + Intronic
997215228 5:132104362-132104384 CTTGCTCCACATCCTCAATCCGG - Intergenic
997391913 5:133524137-133524159 CCTCCTTCTGCCCCTCAAGCAGG - Intronic
997716506 5:136046931-136046953 CGTGTTTCAGCTCATCAGTCAGG - Exonic
998050309 5:139026938-139026960 CTTTCTTCAGTTCCTCAATGGGG + Exonic
1001137854 5:169117286-169117308 GCTCTTCCAGCTCCTCAATCCGG - Intronic
1002120789 5:177002684-177002706 CCTGCCTCAGCCTCTCAAGCTGG - Intronic
1002276622 5:178108126-178108148 CTTGCTTCAGCTCCTCCTCCTGG + Intergenic
1002516895 5:179765643-179765665 CCTGCTTCAGTTCTTTATTCAGG - Exonic
1002593156 5:180304879-180304901 CGTGCTTCAGCTCCCCAGCCAGG + Exonic
1004325979 6:14674363-14674385 CCAGCTGCAGCTTCTCAACCTGG + Intergenic
1005400142 6:25423591-25423613 TATGCTTCAGCTCCTCAGCCAGG - Intronic
1005835764 6:29708169-29708191 CCTTCTTCAGCTCCTTTCTCTGG + Intergenic
1007125661 6:39423553-39423575 CCTGCTTTAGTTCCTGACTCAGG + Intronic
1007414403 6:41683540-41683562 CCAGCTACAGCTTCTCAAGCCGG + Intergenic
1007667106 6:43520990-43521012 CCTTCTTTAGCTTCTCATTCCGG - Exonic
1008038060 6:46767323-46767345 CCTACTTCATCTCATCTATCAGG + Intergenic
1009975148 6:70664177-70664199 GCAGCTTCACCTGCTCAATCAGG + Intergenic
1010509619 6:76702395-76702417 TCTGCTTGAGCTCCTCCCTCTGG + Intergenic
1012165691 6:95948216-95948238 CACATTTCAGCTCCTCAATCTGG - Intergenic
1012253635 6:97008045-97008067 CCTGCTGCACCTCCTCATGCAGG + Intronic
1013054614 6:106571585-106571607 CCTGCTTCAGCCTCTCAAGTAGG - Intergenic
1015112370 6:129607950-129607972 CCTGCTGAAGCTCTTCATTCGGG - Exonic
1016599875 6:145846199-145846221 CTTTCTTCATCTCCTCAAACTGG + Intergenic
1017185468 6:151596403-151596425 CCTGCTTCTCCTCCTCCAGCTGG - Exonic
1017581659 6:155871723-155871745 TCTGCTACAGCTGCTCAAACAGG - Intergenic
1018908268 6:168087748-168087770 CCTGCTTCAGCCCCTCTTTAAGG - Intergenic
1020404837 7:7820577-7820599 TATGCTTCAGCTCCTCAAAATGG + Intronic
1021638911 7:22719210-22719232 CCTGCCTGGGCTCCTCCATCTGG + Intergenic
1027387602 7:77673902-77673924 CCTCTTTCAGCTCCTGAATAAGG + Intergenic
1029066700 7:97856997-97857019 CCTGCTTCAACTCCACCACCAGG + Intronic
1029700490 7:102243551-102243573 CCTGCTTCAGCCTCCCAATGTGG - Intronic
1034294998 7:149964381-149964403 TCTGCTTCAGGTCCTCATTTCGG - Intergenic
1034811063 7:154132565-154132587 TCTGCTTCAGGTCCTCATTTCGG + Intronic
1035331135 7:158098243-158098265 CAGGCTTCAGCTCCGCAATGTGG + Intronic
1036805951 8:11833729-11833751 CCTGTTGCAGCTCCTCAACTCGG - Intronic
1038547157 8:28434667-28434689 CCTGCATCAACTCCTCAACTGGG - Intronic
1040353621 8:46593751-46593773 CCTGCTTCAACTCCACCACCAGG + Intergenic
1041143659 8:54848198-54848220 GCTGCCTCAGCTCCTCACTCAGG - Intergenic
1047357602 8:124138507-124138529 CCTGCCTCAGCTCCTGAATCTGG - Intergenic
1049357975 8:142198170-142198192 GCTGCTTCAGCTCCTAAACTGGG + Intergenic
1049585149 8:143429512-143429534 CCAGCTTCAGCTGCTCCACCTGG + Exonic
1049789892 8:144467710-144467732 GCTGCTTCAGCTCCTCCAGCTGG - Exonic
1050772138 9:9215596-9215618 TGTGCCTCAGCTCCACAATCTGG - Intronic
1051822135 9:21180939-21180961 CCTGCCTCATCTCCTCAATCAGG + Intergenic
1051823368 9:21193001-21193023 CTTGCCTCGTCTCCTCAATCAGG + Intergenic
1051825190 9:21211537-21211559 CCTGCCTCATCTCCTCAATCAGG + Intronic
1051827173 9:21233598-21233620 CCTGCCTCATCTCCTCAATCAGG + Intronic
1052735705 9:32340468-32340490 CCTTCTTCCGCACCTCAATGGGG + Intergenic
1057233049 9:93336686-93336708 CCTGCTTCAGTTCCTCCACATGG - Intronic
1058758681 9:108107824-108107846 CCTTCTTCAGCGCATCATTCTGG - Intergenic
1058835383 9:108855213-108855235 CCTGATGCAGCTGCTCAATGAGG - Exonic
1060117585 9:120955240-120955262 CATACTTCATCTCCTCATTCTGG - Intronic
1060444272 9:123673501-123673523 CCTGCCTCAGCCCCAGAATCAGG + Intronic
1060745103 9:126126113-126126135 CTGGCTCCAGATCCTCAATCAGG + Intergenic
1061055502 9:128220320-128220342 CCTGCAGAAGGTCCTCAATCAGG + Exonic
1061838665 9:133345234-133345256 CCTGCGTCTCGTCCTCAATCTGG + Exonic
1203775764 EBV:72368-72390 CCTGGGTCAGCTCCTGCATCTGG - Intergenic
1186626165 X:11295992-11296014 CCTGATTCAGATCATCATTCAGG + Intronic
1187879420 X:23832549-23832571 TTTGCTTCAGCTCATTAATCTGG + Intergenic
1187882567 X:23860622-23860644 CCTGCCTCAGCCCCTCAAGTAGG + Intronic
1189013363 X:37070301-37070323 CCTGCCTCAGCCTCCCAATCAGG - Intergenic
1190180657 X:48189137-48189159 CTTGCTGCAGCTTCTCCATCAGG - Intronic
1190183561 X:48215480-48215502 CTTGCTGCAGCTTCTCCATCAGG + Intronic
1190193705 X:48298640-48298662 CTTGCTGCAGCTTCTCCATCGGG - Intergenic
1190196635 X:48325173-48325195 CTTGCTGCAGCTTCTCCATCAGG + Intergenic
1190199571 X:48348994-48349016 CTTGCTGCAGCTTCTCCATCAGG - Intronic
1190204327 X:48390456-48390478 CTTGCTGCAGCTTCTCCATCAGG + Intronic
1190206209 X:48404947-48404969 CTTGCTGCAGCTTCTCCATCAGG - Intronic
1190210166 X:48440106-48440128 CTTGCTGCAGCTTCTCCATCAGG + Intergenic
1190382366 X:49852114-49852136 CCTGCTTCAACCCCTATATCAGG - Intergenic
1190572969 X:51803316-51803338 CCTGCCTCACCTCCTCACTCTGG + Intronic
1190655164 X:52605550-52605572 CTTGCTGCAGCTTCTCCATCAGG - Intergenic
1190660222 X:52647270-52647292 CTTGCTGCAGCTTCTCCATCAGG - Intronic
1190663361 X:52675543-52675565 CTTGCTGCAGCTTCTCCATCAGG + Intronic
1190666344 X:52699439-52699461 CTTGCTGCAGCTTCTCCATCAGG - Intronic
1190673074 X:52758971-52758993 CTTGCTGCAGCTTCTCCATCAGG + Intronic
1190676062 X:52782939-52782961 CTTGCTGCAGCTTCTCCATCAGG - Intronic
1191019231 X:55842145-55842167 CCTGCCTGATCACCTCAATCAGG - Intergenic
1191626297 X:63274803-63274825 CCTTTTTCATCCCCTCAATCAGG - Intergenic
1195879048 X:109573710-109573732 CCAGATACAGCTGCTCAATCTGG + Intergenic
1198322383 X:135531356-135531378 CCATCTTCAGCTTCTCACTCAGG + Intronic
1201645344 Y:16223837-16223859 CCTGCTTCAGCTCCTGCATGGGG + Intergenic
1201657469 Y:16361485-16361507 CCTGCTTCAGCTCCTGCATGGGG - Intergenic