ID: 1119549027

View in Genome Browser
Species Human (GRCh38)
Location 14:75494680-75494702
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119549027_1119549040 25 Left 1119549027 14:75494680-75494702 CCTTTCTTGAAAGATGGGGAGAT No data
Right 1119549040 14:75494728-75494750 ATGATGCCCAAAGGGTCCCTGGG No data
1119549027_1119549039 24 Left 1119549027 14:75494680-75494702 CCTTTCTTGAAAGATGGGGAGAT No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549027_1119549033 16 Left 1119549027 14:75494680-75494702 CCTTTCTTGAAAGATGGGGAGAT No data
Right 1119549033 14:75494719-75494741 CCCATCCCCATGATGCCCAAAGG No data
1119549027_1119549035 17 Left 1119549027 14:75494680-75494702 CCTTTCTTGAAAGATGGGGAGAT No data
Right 1119549035 14:75494720-75494742 CCATCCCCATGATGCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119549027 Original CRISPR ATCTCCCCATCTTTCAAGAA AGG (reversed) Intergenic
No off target data available for this crispr