ID: 1119549029

View in Genome Browser
Species Human (GRCh38)
Location 14:75494710-75494732
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119549029_1119549039 -6 Left 1119549029 14:75494710-75494732 CCCCATCTTCCCATCCCCATGAT No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549029_1119549040 -5 Left 1119549029 14:75494710-75494732 CCCCATCTTCCCATCCCCATGAT No data
Right 1119549040 14:75494728-75494750 ATGATGCCCAAAGGGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119549029 Original CRISPR ATCATGGGGATGGGAAGATG GGG (reversed) Intergenic
No off target data available for this crispr