ID: 1119549031

View in Genome Browser
Species Human (GRCh38)
Location 14:75494712-75494734
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119549031_1119549039 -8 Left 1119549031 14:75494712-75494734 CCATCTTCCCATCCCCATGATGC No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549031_1119549040 -7 Left 1119549031 14:75494712-75494734 CCATCTTCCCATCCCCATGATGC No data
Right 1119549040 14:75494728-75494750 ATGATGCCCAAAGGGTCCCTGGG No data
1119549031_1119549045 30 Left 1119549031 14:75494712-75494734 CCATCTTCCCATCCCCATGATGC No data
Right 1119549045 14:75494765-75494787 TGTCCTCTCATTGTGTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119549031 Original CRISPR GCATCATGGGGATGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr