ID: 1119549039

View in Genome Browser
Species Human (GRCh38)
Location 14:75494727-75494749
Sequence CATGATGCCCAAAGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119549031_1119549039 -8 Left 1119549031 14:75494712-75494734 CCATCTTCCCATCCCCATGATGC No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549027_1119549039 24 Left 1119549027 14:75494680-75494702 CCTTTCTTGAAAGATGGGGAGAT No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549029_1119549039 -6 Left 1119549029 14:75494710-75494732 CCCCATCTTCCCATCCCCATGAT No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549030_1119549039 -7 Left 1119549030 14:75494711-75494733 CCCATCTTCCCATCCCCATGATG No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data
1119549028_1119549039 0 Left 1119549028 14:75494704-75494726 CCAACACCCCATCTTCCCATCCC No data
Right 1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119549039 Original CRISPR CATGATGCCCAAAGGGTCCC TGG Intergenic
No off target data available for this crispr