ID: 1119550240

View in Genome Browser
Species Human (GRCh38)
Location 14:75504745-75504767
Sequence TCCCATTAGGCCCCACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119550236_1119550240 -5 Left 1119550236 14:75504727-75504749 CCTCATGACCTAAACACCTCCCA 0: 93
1: 1068
2: 3098
3: 6930
4: 9516
Right 1119550240 14:75504745-75504767 TCCCATTAGGCCCCACTTACTGG No data
1119550235_1119550240 -4 Left 1119550235 14:75504726-75504748 CCCTCATGACCTAAACACCTCCC 0: 51
1: 536
2: 1995
3: 4419
4: 7815
Right 1119550240 14:75504745-75504767 TCCCATTAGGCCCCACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119550240 Original CRISPR TCCCATTAGGCCCCACTTAC TGG Intergenic
No off target data available for this crispr