ID: 1119553336

View in Genome Browser
Species Human (GRCh38)
Location 14:75533641-75533663
Sequence AGTCCCCTGCTTCCTAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119553332_1119553336 -4 Left 1119553332 14:75533622-75533644 CCTCTTTTGAACTTAGTCTAGTC 0: 1
1: 0
2: 0
3: 6
4: 155
Right 1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1119553329_1119553336 30 Left 1119553329 14:75533588-75533610 CCTTGTGCAAGCTTCTCAGAGGT 0: 1
1: 0
2: 1
3: 18
4: 154
Right 1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1119553331_1119553336 -3 Left 1119553331 14:75533621-75533643 CCCTCTTTTGAACTTAGTCTAGT 0: 1
1: 1
2: 0
3: 17
4: 179
Right 1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 132
1119553330_1119553336 -2 Left 1119553330 14:75533620-75533642 CCCCTCTTTTGAACTTAGTCTAG 0: 1
1: 1
2: 0
3: 19
4: 136
Right 1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119553336 Original CRISPR AGTCCCCTGCTTCCTAGGAG GGG Intronic
902231111 1:15028214-15028236 AGTCCCCACATTCCCAGGAGCGG + Intronic
902572119 1:17353572-17353594 TCTCCCCTGCCTCCCAGGAGAGG - Intronic
902885554 1:19402294-19402316 AGGCCACTGCCTCCTAGGAAAGG + Intronic
904415342 1:30358033-30358055 AGACACCTGCCTCCCAGGAGGGG + Intergenic
905230954 1:36514674-36514696 AGTGCCCTGCTCCCTGGTAGGGG + Intergenic
905530242 1:38672649-38672671 AGGCTTCTGCTTACTAGGAGAGG - Intergenic
910511567 1:88012248-88012270 AGACCCTTGCTTCCTAGTAAAGG + Intergenic
915270464 1:154749959-154749981 ATTTCCCTGCTTTCTGGGAGTGG + Intronic
916249542 1:162723804-162723826 AGTTGCCTGCTTCCTATGAGGGG - Intronic
916674210 1:167052738-167052760 ACTCTTCTGCTTCCTAGGGGAGG - Intergenic
918094820 1:181325879-181325901 TGTCCCCTGCGGCCTGGGAGGGG - Intergenic
918723097 1:187879517-187879539 AGTCACTTGCATCCTGGGAGAGG + Intergenic
920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG + Intergenic
920495310 1:206450604-206450626 ATTCCCTTCCTTCCTTGGAGAGG + Intronic
922163760 1:223097734-223097756 AAGCCCCAGCTTCCTGGGAGAGG + Intergenic
1063288579 10:4716545-4716567 AGTCTCCTGCTTCCTACGTTAGG + Intergenic
1064585143 10:16832680-16832702 GGCCCCATTCTTCCTAGGAGAGG - Intronic
1064810087 10:19187210-19187232 AGGGCCCTGCTTCCTAGCTGGGG + Intronic
1071600874 10:86958214-86958236 TGTCCCCAGCTTCCTAGGTAGGG - Intronic
1072223605 10:93348169-93348191 TGTGCTCTGCTTCCTGGGAGGGG + Intronic
1073759392 10:106613450-106613472 AGTCCCCTGCGTTCCAGGAATGG + Intronic
1076770004 10:132657599-132657621 GGCCCGCTGCTTCCTGGGAGAGG + Intronic
1077774881 11:5259313-5259335 AGTCCCCCTTTTCCTAGGCGTGG - Intronic
1081347908 11:42012890-42012912 TGACCCCTGCTTCCCATGAGAGG + Intergenic
1095408409 12:41893804-41893826 AATCCCCTGGTTGCTAGGTGGGG + Intergenic
1096529876 12:52235838-52235860 AGGTCCCTGACTCCTAGGAGAGG + Intronic
1099130482 12:78823450-78823472 AGTCCTATGTTTTCTAGGAGAGG - Intergenic
1100618289 12:96248550-96248572 GCTACCCTGCTTCCTAGGAGTGG + Intronic
1100815213 12:98380462-98380484 AGTCCCCTGCCCCCAAGGACTGG + Intergenic
1107047234 13:36006574-36006596 AGGCCAGTGCTTCCCAGGAGAGG + Intronic
1108481573 13:50877772-50877794 AGCCTCGTGCTTTCTAGGAGGGG + Intergenic
1113778796 13:112963935-112963957 AGTCCCCTGCGTCCTTGGGGTGG - Intronic
1118850485 14:69579359-69579381 ACTCACCTGCTTCTTATGAGTGG + Intergenic
1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG + Intronic
1122770390 14:104095202-104095224 AGCCCCCTGCTGCCATGGAGAGG + Intronic
1122811557 14:104291855-104291877 AGAGCCCTGCTTGCTGGGAGGGG + Intergenic
1122828347 14:104383248-104383270 AGGGCCCTGCTTGCTAGAAGAGG + Intergenic
1124973980 15:34516532-34516554 AGTCCCCTGATTCCTGAGACTGG + Intergenic
1128544309 15:68556881-68556903 AGTCCCCTCCTCACTAGGAAGGG - Intergenic
1131066070 15:89435766-89435788 GGTCCCTGGCTGCCTAGGAGGGG - Intergenic
1131970399 15:97886783-97886805 AGTCTACTGGTTCCTAGGACAGG - Intergenic
1132310651 15:100855017-100855039 AGTGCCCTGGGGCCTAGGAGAGG + Intergenic
1132316504 15:100894128-100894150 GGTGGCCTGGTTCCTAGGAGTGG - Intronic
1134463683 16:14452683-14452705 AGTCTTTTGCTTCCTAGGAGAGG + Intronic
1134674858 16:16083038-16083060 AAACCCCTGCTTCCAAAGAGTGG - Intronic
1138397485 16:56716636-56716658 AGTCCTCTGATTTCTAAGAGTGG + Intronic
1143263924 17:5621499-5621521 AGTCCCCCGCTGGCTGGGAGAGG + Intergenic
1143350497 17:6284643-6284665 AGAAGCCTGCTTCCTGGGAGAGG + Intergenic
1144157171 17:12516948-12516970 AGTCCCCTATTTTCTGGGAGGGG - Intergenic
1144673294 17:17145136-17145158 AGTCCGCTGCTGCCTAGGTCTGG - Intronic
1146054516 17:29574435-29574457 AGGCCCCTGCTCACTAGGAGGGG + Exonic
1147394301 17:40129598-40129620 AGTCTCCTCCTTCTTTGGAGAGG - Exonic
1151043774 17:70895510-70895532 ATTCCACTTCTTCCTGGGAGGGG - Intergenic
1152702380 17:81825443-81825465 AGTCCCAGGATTCCCAGGAGGGG + Exonic
1157719486 18:49912836-49912858 AGGCTCCTGCTTCTGAGGAGTGG - Intronic
1161417197 19:4153961-4153983 GTCCCCCTGCCTCCTAGGAGCGG + Intronic
1167067740 19:47199546-47199568 AAGGCCCTGCTTCCTAGAAGAGG - Intronic
1167338046 19:48898595-48898617 GGTCCCCAGCTTCCAAAGAGAGG - Exonic
927365629 2:22292774-22292796 AGTCCCATGATTCCTATAAGGGG + Intergenic
930086726 2:47503163-47503185 ATTCCCCTCCTTCATTGGAGAGG + Intronic
932296902 2:70632245-70632267 AGTCCCCTGTCTCCCAGGAATGG - Intronic
932940516 2:76159622-76159644 TGTCCCCAGATTCCTGGGAGTGG - Intergenic
936021171 2:108996174-108996196 AGTTCCCTGCTGCCTAACAGTGG + Intergenic
943371661 2:187023494-187023516 AGTCCCCAGATTCCTGGGAGGGG - Intergenic
943676065 2:190717495-190717517 AGTCATCTGCTTCCTTGGGGGGG + Intergenic
1170306870 20:14948040-14948062 AGTCCTCTGATGCCTTGGAGGGG - Intronic
1170864762 20:20143381-20143403 AGTCCCCTCTTTGCTGGGAGGGG - Intronic
1171869068 20:30511800-30511822 AGTGCCCTTCTTCCTGGGAAGGG - Intergenic
1174091402 20:48051544-48051566 AGTGCCCTGGTTCCATGGAGAGG + Intergenic
1175827256 20:61942891-61942913 AGTCCCCTCTCCCCTAGGAGAGG + Intergenic
1178995031 21:37391126-37391148 AGTGCCCTGGTTCTTTGGAGTGG + Intronic
1182518764 22:30873450-30873472 AGTCCCTGGCTTCCCAGGAGGGG - Intronic
1182520760 22:30883350-30883372 AGTCCCCTGCATCCCGGGACTGG - Intronic
1183371613 22:37435689-37435711 AGTCCCCAGACTCCTTGGAGAGG + Intergenic
949922304 3:9012700-9012722 ACTCCCCTGCTTCCTGAGATGGG + Intronic
952188450 3:30996564-30996586 AGCTCACTGCTTCCTGGGAGTGG - Intergenic
958252650 3:91288387-91288409 CGTCCCCTGGTTCCCATGAGAGG + Intergenic
960088574 3:113616205-113616227 ATTCCCCTGCTTTCTGGGACAGG - Intronic
960983140 3:123250541-123250563 AATCCACTGCTTCCTAAGAGTGG - Intronic
962391735 3:134978061-134978083 AGTCACCTGCTTCCTCAGAGGGG - Intronic
966059890 3:175741958-175741980 AGTCCCCTCCCTCCTTTGAGTGG - Intronic
968280941 3:197476281-197476303 ATTTCCCTGCCTCCTACGAGTGG + Intergenic
970802301 4:19987866-19987888 AGTCATCTGAATCCTAGGAGAGG - Intergenic
971038218 4:22719329-22719351 AGTGCAGTGTTTCCTAGGAGAGG + Intergenic
982169143 4:152644291-152644313 ACTCTCCTGCTTCCCAGGCGGGG - Intronic
982375957 4:154690825-154690847 TGTCCCCTGCTTCTTAAAAGGGG + Intronic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
983587929 4:169375759-169375781 AATAACCTGCTTCCTTGGAGAGG + Intergenic
985416235 4:189738386-189738408 ACTGGCCTGCTTCCTAGCAGAGG - Intergenic
986480968 5:8187631-8187653 ACTCCCAGGCTTCCCAGGAGGGG - Intergenic
989398900 5:40988067-40988089 AGTTCCTTGCTTCTTATGAGTGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1002641833 5:180634094-180634116 AGGTCCATGCCTCCTAGGAGAGG - Intronic
1004289335 6:14352013-14352035 AATGTCCTGCTTCCCAGGAGAGG + Intergenic
1006806380 6:36792269-36792291 AGTGCACTGCTTCCTGGGACCGG + Intronic
1006964190 6:37965538-37965560 ATTCCACTGCTTCCCAGGTGAGG + Intronic
1007806987 6:44457832-44457854 ATTCCTCTGCTTTCTAAGAGAGG - Intergenic
1009191827 6:60638537-60638559 CGTCCCCTGGTTCCAATGAGAGG - Intergenic
1012755734 6:103228002-103228024 GGTGCCCTGCTTTCTAGCAGTGG + Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1015921467 6:138270145-138270167 TGTGCCCTGTCTCCTAGGAGGGG - Intronic
1017118000 6:150996899-150996921 ATTCGCCTGCTTTCTAGGTGCGG + Intronic
1017915936 6:158831731-158831753 CATCCCCTGGTTCCTAGGTGGGG + Intergenic
1018891485 6:167986180-167986202 AGTCCCCTTCTGACAAGGAGTGG + Intergenic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1019913813 7:4117856-4117878 CTTTCCCTCCTTCCTAGGAGAGG + Intronic
1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG + Intergenic
1022726527 7:32986628-32986650 AATCTCCTGCTTCCTGGGTGAGG + Intronic
1024097808 7:45998854-45998876 TGTTGCCTGCTTCCTAAGAGGGG - Intergenic
1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG + Intergenic
1025047058 7:55701005-55701027 AATCTCCTGCTTCCTGGGTGAGG - Intergenic
1025953444 7:66164227-66164249 GGTCCCCTGCCTTCTGGGAGAGG + Intergenic
1026260692 7:68752824-68752846 AGTCTCCTTCTTCCTAGGCCTGG + Intergenic
1028318819 7:89436114-89436136 AGTCCCCTGGTTGCAGGGAGGGG - Intergenic
1029206570 7:98872547-98872569 AGTCCCCTTGTTCCTAGGCCTGG - Intergenic
1033016685 7:137678580-137678602 AGACCTCTGCTACCTTGGAGAGG - Exonic
1034964703 7:155383977-155383999 AACCCCCTGCTTCCCAGGAGGGG + Intronic
1036478127 8:9112642-9112664 AGTGCCTGGCTTCATAGGAGAGG - Intronic
1036603412 8:10284611-10284633 AGTCCCCTCCCTACTTGGAGTGG + Intronic
1037706917 8:21323099-21323121 AGGCACCTGCTTCCTGGGATGGG - Intergenic
1037735999 8:21566605-21566627 AGTGCCCAGCTTCCAGGGAGGGG - Intergenic
1038372033 8:27003873-27003895 AGTCCCCTCCATCATAGAAGGGG + Intergenic
1042784573 8:72534354-72534376 AGTACCCTGCTTCCCAGAAATGG + Intergenic
1046112561 8:109743668-109743690 AGTCCCCATTTTCCTATGAGAGG + Intergenic
1047006263 8:120623462-120623484 TGTGCCCTGGTTCCTAGGGGAGG - Intronic
1047208610 8:122822642-122822664 GGACCTCTGCTTCCCAGGAGTGG - Intronic
1049256264 8:141615539-141615561 AGACCACTGCTCCCCAGGAGGGG - Intergenic
1049361242 8:142213324-142213346 AGTGGCCTGCTCCCCAGGAGAGG - Intronic
1049656282 8:143799754-143799776 CGTCTCCTGCTTTCTAGGACTGG - Intronic
1050430100 9:5553492-5553514 AGGCCCCTGTTTCCCTGGAGAGG - Intronic
1054829583 9:69608661-69608683 AGTCCCCTTCTCCCTCGAAGTGG + Intronic
1055308482 9:74953812-74953834 AGTTCCCTGCTTACTATGGGCGG + Intergenic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1055916130 9:81402067-81402089 AATCCCATGCTACCTAGGAGAGG - Intergenic
1057867692 9:98694134-98694156 AGTCCACTGCAGCCCAGGAGTGG - Intronic
1058181299 9:101803352-101803374 ACTCCCCTCCTTCCTGGCAGAGG + Intergenic
1061226375 9:129283286-129283308 AGACCCCTGCTGCCAAGGGGCGG + Intergenic
1061923951 9:133796966-133796988 AATGCCCTGGTTCCTGGGAGTGG - Intronic
1062186863 9:135222954-135222976 AGGCCCCTGCTTCCAATAAGCGG - Intergenic
1062273921 9:135721845-135721867 AGGACCCTGCTTCCTGGTAGGGG - Intronic
1062729928 9:138103122-138103144 TGTCCCCTCATTCCTAGGAAAGG - Intronic
1189994808 X:46628265-46628287 AGTCCCCTGCTTTATCGGGGTGG + Intronic
1199691822 X:150314284-150314306 AGTCCCCTGCTTCCTGGGGTGGG - Intergenic
1202239952 Y:22756599-22756621 TGTACCCTTCTTCCTAAGAGGGG + Intergenic
1202392938 Y:24390361-24390383 TGTACCCTTCTTCCTAAGAGGGG + Intergenic
1202477847 Y:25279756-25279778 TGTACCCTTCTTCCTAAGAGGGG - Intergenic