ID: 1119554453

View in Genome Browser
Species Human (GRCh38)
Location 14:75542563-75542585
Sequence GTCCCCTCTGGCCCTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 468}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119554453_1119554459 -9 Left 1119554453 14:75542563-75542585 CCCCAAGGAGGGCCAGAGGGGAC 0: 1
1: 0
2: 1
3: 57
4: 468
Right 1119554459 14:75542577-75542599 AGAGGGGACTGGGCAATAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 174
1119554453_1119554462 1 Left 1119554453 14:75542563-75542585 CCCCAAGGAGGGCCAGAGGGGAC 0: 1
1: 0
2: 1
3: 57
4: 468
Right 1119554462 14:75542587-75542609 GGGCAATAGCAGGGACATGGAGG 0: 1
1: 0
2: 3
3: 19
4: 242
1119554453_1119554464 8 Left 1119554453 14:75542563-75542585 CCCCAAGGAGGGCCAGAGGGGAC 0: 1
1: 0
2: 1
3: 57
4: 468
Right 1119554464 14:75542594-75542616 AGCAGGGACATGGAGGGACGAGG 0: 1
1: 0
2: 4
3: 148
4: 2475
1119554453_1119554460 -8 Left 1119554453 14:75542563-75542585 CCCCAAGGAGGGCCAGAGGGGAC 0: 1
1: 0
2: 1
3: 57
4: 468
Right 1119554460 14:75542578-75542600 GAGGGGACTGGGCAATAGCAGGG 0: 1
1: 0
2: 1
3: 16
4: 274
1119554453_1119554461 -2 Left 1119554453 14:75542563-75542585 CCCCAAGGAGGGCCAGAGGGGAC 0: 1
1: 0
2: 1
3: 57
4: 468
Right 1119554461 14:75542584-75542606 ACTGGGCAATAGCAGGGACATGG 0: 1
1: 0
2: 3
3: 20
4: 258
1119554453_1119554463 2 Left 1119554453 14:75542563-75542585 CCCCAAGGAGGGCCAGAGGGGAC 0: 1
1: 0
2: 1
3: 57
4: 468
Right 1119554463 14:75542588-75542610 GGCAATAGCAGGGACATGGAGGG 0: 1
1: 0
2: 3
3: 94
4: 1874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119554453 Original CRISPR GTCCCCTCTGGCCCTCCTTG GGG (reversed) Intronic
900555588 1:3278803-3278825 GTCCCCTCTGACGTTCCCTGTGG - Intronic
900674034 1:3872829-3872851 GTCCCCTCCAGTCCTCCCTGTGG + Intronic
901024281 1:6270855-6270877 GGGCCATCTGGCCCTCCTTTGGG - Intronic
902032070 1:13430448-13430470 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
902642498 1:17775750-17775772 GTCCCTTTTGGGGCTCCTTGAGG + Intronic
903197964 1:21707574-21707596 TTCTCCTCTGGCTCTACTTGTGG + Intronic
903624536 1:24721411-24721433 GCCCACTCTGGCCATGCTTGAGG + Intergenic
903925707 1:26829088-26829110 GTCCCCGCTTGTCCTCATTGGGG + Intronic
904800397 1:33088450-33088472 ATCCCCTTGGGCCCTCCTTCAGG + Intronic
905033961 1:34905145-34905167 GCCCCCGCTGGCCCTCCCTCAGG + Exonic
906056046 1:42917462-42917484 ATCCGCTCTGGCCATGCTTGAGG - Intergenic
906876081 1:49541219-49541241 GCCCACTCTGGCCATGCTTGAGG + Intronic
907380154 1:54080525-54080547 TGCCCTTTTGGCCCTCCTTGGGG + Intronic
908299859 1:62753317-62753339 GTCCACTCTCGCCATGCTTGAGG + Intergenic
908301034 1:62761399-62761421 GTCCACTCTGGCCCCACTTGAGG + Intergenic
909782350 1:79561999-79562021 GTCCACTCTGGCCACACTTGAGG - Intergenic
910334270 1:86110445-86110467 GTCCACTCTGGCCGCGCTTGAGG + Intronic
910550216 1:88466944-88466966 GTCCGCTCTGGCCATGCTCGGGG + Intergenic
911533193 1:99070632-99070654 TGCCCCTCTGGACCTCCTTCTGG - Intergenic
911950807 1:104172211-104172233 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
912332824 1:108834965-108834987 GCCTCCTGCGGCCCTCCTTGGGG + Exonic
915795674 1:158731249-158731271 GTTCTCTCTGTCCCTCCCTGTGG + Intergenic
916578641 1:166088757-166088779 GCCCCCTCTGCCCCTCCCCGTGG - Intronic
917094049 1:171382161-171382183 GTCTGCTCTGGCCATACTTGAGG - Intergenic
918154510 1:181832301-181832323 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
918443939 1:184597399-184597421 GTCACTTGTGCCCCTCCTTGTGG + Intronic
918446996 1:184626398-184626420 GTCCACACTGGCCCTCCTTTGGG - Exonic
918789898 1:188812973-188812995 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
918943043 1:191026469-191026491 GTCTGCTCTGGCCATGCTTGAGG - Intergenic
919250778 1:195054207-195054229 GCCCACTCTGGCCATGCTTGAGG + Intergenic
919799453 1:201344692-201344714 GTCTACCCTGGGCCTCCTTGAGG + Intergenic
920604933 1:207371870-207371892 GTCCGCTCTGGCCATGCTTGAGG - Intergenic
921094494 1:211874767-211874789 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
921457987 1:215394882-215394904 GTCCGCTCTGGTCCTGCTCGGGG - Intergenic
922166209 1:223117410-223117432 GCCCACTCTGGCCGTGCTTGAGG - Intronic
922546785 1:226464082-226464104 GTCCACTATGGCCATGCTTGAGG + Intergenic
922624719 1:227027464-227027486 GTCCTCTCTGGCCTTCTTGGCGG + Intronic
922674125 1:227540719-227540741 GTTCCCTCTGCCACTCCTGGGGG + Intergenic
922797352 1:228347014-228347036 GTCCCCTCTGCCTTCCCTTGGGG + Intronic
923353113 1:233129009-233129031 GTCTGCTCTGGCCATGCTTGGGG + Intronic
924034854 1:239925243-239925265 GTCCACTCTGGCTGTGCTTGAGG - Intergenic
924313800 1:242774677-242774699 GTCCACTCTGGCCACTCTTGAGG - Intergenic
924898783 1:248372712-248372734 GTCACCTCTGGACCTTCCTGGGG - Intergenic
1062760469 10:13153-13175 GTTCCCTCTGCCACTCCTGGGGG - Intergenic
1063982906 10:11470264-11470286 GTCCCCGCGGGCCCTCCATGAGG - Intronic
1064427859 10:15245757-15245779 GTCCCCTGTAGCCCTCCCAGGGG - Intronic
1065284851 10:24177172-24177194 GTCCACTCTGGTCATGCTTGAGG - Intronic
1065983918 10:30930514-30930536 GTCCACTCTGGCCACGCTTGAGG - Intronic
1066568632 10:36748199-36748221 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1066590627 10:36989764-36989786 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1066615128 10:37285641-37285663 GTCCACTCTGGCCACACTTGAGG - Intronic
1066648440 10:37634356-37634378 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1067104209 10:43355003-43355025 GTCACCTCTGGCCTTCCATCAGG + Intergenic
1067816851 10:49485182-49485204 GGCCCCTCTGTCCTTCCTTGGGG - Intronic
1068216602 10:53990696-53990718 GTCCACTCTGGCCACACTTGAGG + Intronic
1070172664 10:73944512-73944534 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1070306841 10:75244863-75244885 GGCCCCTCTGGATCTCCCTGTGG + Intergenic
1070942627 10:80359958-80359980 GCCCACTCTGGCCATGCTTGAGG - Intronic
1071332117 10:84571086-84571108 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1071611075 10:87031439-87031461 GTCCACTCTGGCCATGCTTGAGG - Intergenic
1073094518 10:100971589-100971611 GCACCCTCTGGCCCTGCCTGTGG + Intronic
1074197811 10:111204859-111204881 GTGCCATCTGGTCCTCCCTGTGG - Intergenic
1075622668 10:123939348-123939370 GTCCCCTCTTGCCATCCTGGTGG + Intronic
1076687596 10:132205063-132205085 CTCCCCACAGGCTCTCCTTGTGG + Exonic
1076883249 10:133249628-133249650 GCCCACTCTGGGCCTCGTTGTGG - Intergenic
1077225491 11:1437532-1437554 GTCACTTCTGCCCCTCCCTGGGG + Intronic
1077469201 11:2748891-2748913 GTGCCCTCTTCCCCTCTTTGCGG + Intronic
1078104741 11:8351434-8351456 GTCCCCTGTGGCCCTCATGGTGG - Intergenic
1078222893 11:9365931-9365953 GTGCCCTGAGGACCTCCTTGAGG - Intergenic
1078452853 11:11453198-11453220 GTCTCCTCAGGCCGTACTTGGGG - Intronic
1081127005 11:39333542-39333564 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1081324527 11:41728558-41728580 GTCCACTCTGGCCGTGCTTGAGG - Intergenic
1082912394 11:58391046-58391068 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1083596467 11:63920278-63920300 GTCCCCTCGGCCTCACCTTGAGG - Intergenic
1084259436 11:67965965-67965987 GTCCCCTCTGGCCCAGCTGATGG - Intergenic
1084362378 11:68677454-68677476 CTTCCCACTGCCCCTCCTTGTGG + Intergenic
1085128585 11:74018717-74018739 TTCCCCTCTGCTCCTACTTGTGG - Intronic
1085272308 11:75277617-75277639 GCCCCCTCTGCCACTCCTTTAGG + Intronic
1086001155 11:81987150-81987172 GTCCACTCTGGCCGCACTTGAGG - Intergenic
1086902848 11:92387143-92387165 GTTCCAACTGGACCTCCTTGTGG - Intronic
1087338148 11:96869085-96869107 GATCCCTCTGACCCTCCTCGTGG - Intergenic
1087400934 11:97666968-97666990 GTCCACTCTAGCCATGCTTGAGG + Intergenic
1087441248 11:98185693-98185715 GTTCACTCTGGCCATGCTTGAGG - Intergenic
1087682407 11:101231810-101231832 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1088683081 11:112261072-112261094 CTCACCTCTGGCCGACCTTGAGG + Intronic
1088844030 11:113649789-113649811 GTCTGCTCTGGCCATGCTTGAGG - Intergenic
1089143041 11:116303012-116303034 TACCCATCTGGCCCTCCTTGGGG - Intergenic
1090098145 11:123764413-123764435 TTCCCTTCAGGCCCACCTTGTGG + Intergenic
1090502592 11:127275949-127275971 GGCACCTCTGGGCCTGCTTGCGG + Intergenic
1091283899 11:134397530-134397552 CTGCCCTCTGGCCCCCCCTGTGG - Intronic
1091826142 12:3514338-3514360 GGACCCTCTGGCTCACCTTGTGG + Intronic
1092951484 12:13507587-13507609 GTCCCCTCAGCCCCTCATAGAGG - Intergenic
1093001238 12:13998856-13998878 ATCCCCTCTGTCCCTTCATGAGG + Intergenic
1093583340 12:20807904-20807926 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1093731775 12:22573369-22573391 ATCCCCTCTGGCCCCCATTCTGG + Intergenic
1095642752 12:44502970-44502992 GTCCACTCTGGCCATGCTCGAGG - Intergenic
1098715184 12:73821331-73821353 TTCCCCTCTTGCCCTCGTAGTGG + Intergenic
1099190268 12:79554479-79554501 GTCCGCTCTGGCCACACTTGAGG - Intergenic
1099192378 12:79573804-79573826 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1102039687 12:109792835-109792857 CTCCCCTCTGGCCTCTCTTGTGG - Intronic
1102245903 12:111355623-111355645 CTCCCCTCTGTCCCTCCCTGGGG - Intergenic
1102495795 12:113318923-113318945 GTCCCCACTGGTCCTCTCTGGGG + Intronic
1103778702 12:123384743-123384765 GGCCCCGCTGGCCCACTTTGGGG + Intronic
1105416955 13:20221595-20221617 GTCCCATCTGGAAATCCTTGGGG + Intergenic
1105697289 13:22900879-22900901 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1105701599 13:22939112-22939134 GTCCACTCTGGCCACGCTTGAGG - Intergenic
1105883423 13:24623243-24623265 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1106162230 13:27212050-27212072 GTCCGCTCTGGCCACGCTTGAGG + Intergenic
1108362363 13:49678753-49678775 ATCCACTCTGGCCATGCTTGAGG - Intronic
1108615296 13:52126990-52127012 GGCTCCTATGGCCCTCCTTAGGG - Intronic
1108685531 13:52815691-52815713 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1108686671 13:52826159-52826181 GTCCGCTCTGGCCACGCTTGAGG + Intergenic
1108845604 13:54676473-54676495 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1109037791 13:57287081-57287103 GTCCACTCTGGCCCCTCTTCAGG - Intergenic
1109638161 13:65150032-65150054 GCCCGCTCTGGCCATGCTTGAGG - Intergenic
1111138854 13:84086851-84086873 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1111220837 13:85204791-85204813 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1112077829 13:95931911-95931933 GTCCGCTCTGGCCATGCTCGAGG - Intronic
1113330245 13:109319535-109319557 GTCCACTCTGGCCATGCTTGAGG - Intergenic
1114155470 14:20099072-20099094 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1114282330 14:21204440-21204462 GTCCCCATTGGCCCTCCTGGGGG - Intergenic
1114679508 14:24473035-24473057 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1114957688 14:27845245-27845267 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
1115044550 14:28975287-28975309 GTCCCCTCTCGTCCTCCTCAGGG - Intergenic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1116974599 14:51101585-51101607 GTGGCCCCTGGCCATCCTTGAGG - Intergenic
1119554453 14:75542563-75542585 GTCCCCTCTGGCCCTCCTTGGGG - Intronic
1120140893 14:80928092-80928114 CTCCCCGCTGCCCCACCTTGAGG - Intronic
1120169618 14:81235984-81236006 GTCCACTCTGGCCATGCTCGAGG + Intergenic
1120214739 14:81669186-81669208 GTCCGCTCTGGCCACTCTTGAGG - Intergenic
1121463615 14:94100488-94100510 GTCTCCTCTGCCCAGCCTTGTGG - Intronic
1121541210 14:94728124-94728146 GTCCTCTCTGGATCTCCTTTGGG + Intergenic
1121656213 14:95597765-95597787 GTCTCCTGTGGCCCTCCTCAGGG + Intergenic
1121726807 14:96158323-96158345 GTCACCTATGGCCCTCCTGCTGG - Intergenic
1122141675 14:99666655-99666677 CTCCCCTCTGGGCCTCTTTCTGG - Intronic
1122354596 14:101115248-101115270 GTCCCCGCTGTCCCTCCTGCTGG + Intergenic
1122405620 14:101499081-101499103 AGCCCCTCTGGCCATCCTTGTGG - Intergenic
1122651536 14:103229513-103229535 GTGCACCCTGGCCCTGCTTGGGG - Intergenic
1122651951 14:103231077-103231099 CCCCTCTCTGGCCCTCCTGGGGG - Intergenic
1123113547 14:105883772-105883794 CTGCCCTCTGGCCCTCTGTGGGG - Intergenic
1123403048 15:20005006-20005028 GTCACCTCGGCCCCTCCTGGAGG - Intergenic
1123512388 15:21011660-21011682 GTCACCTCAGCCCCTCCTGGAGG - Intergenic
1124161264 15:27271971-27271993 CTTCCCTCTGACTCTCCTTGAGG + Intronic
1125534112 15:40433381-40433403 GCCCCCTCTGGACCTCCTGCCGG + Intronic
1125834271 15:42736513-42736535 GGCCCCTCTGGCCCGCCGCGGGG - Exonic
1126997515 15:54462341-54462363 GTCCACTGTGGCCATGCTTGAGG + Intronic
1127546354 15:59997159-59997181 GTGCACTCTGGCCCTCCTCGCGG - Intergenic
1127623674 15:60759211-60759233 GTTCTCTCAGGCTCTCCTTGGGG - Intronic
1127802888 15:62493049-62493071 GTTCCCTCTGGCCTTCTTTGGGG + Intronic
1128475298 15:67992183-67992205 GTGCCCTGTGGCCCTTCTGGAGG - Intergenic
1129586917 15:76876287-76876309 GTCCACTCTGGCCATGCTCGGGG - Intronic
1130162302 15:81413929-81413951 GTCCGCTCTGGCCGCACTTGAGG + Intergenic
1130467163 15:84198236-84198258 GTCCCCTCTGGAGGTACTTGGGG - Intergenic
1130497101 15:84475300-84475322 GTCCCCTCTGGAGGTACTTGGGG + Intergenic
1131005041 15:88971062-88971084 GTCCGCTCTGGCCACGCTTGAGG - Intergenic
1131250192 15:90825407-90825429 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1132799751 16:1746151-1746173 GTGGCCCCCGGCCCTCCTTGAGG - Intronic
1133500021 16:6357103-6357125 CTCCCCTCCTGCCCTGCTTGCGG + Intronic
1135470270 16:22723416-22723438 GTCCGCTCTGGCCATGCTCGAGG - Intergenic
1136289229 16:29261625-29261647 GTCCCCTCAGGCACTCCTGGTGG - Intergenic
1137658354 16:50180808-50180830 GACCCCACTGCCCCTTCTTGAGG - Intronic
1138118411 16:54378773-54378795 CTCCCCTCTCTCCATCCTTGAGG - Intergenic
1138457779 16:57131316-57131338 GTCCTCTCTGGTCCTCTCTGGGG + Intronic
1138510112 16:57503842-57503864 CTCCCCTCTGGGCCTCAGTGGGG - Intergenic
1138530498 16:57631823-57631845 GCCCCATCTGGGGCTCCTTGAGG + Intronic
1139419992 16:66844317-66844339 GGCCTCTCTGGCCCTGCTGGGGG + Intronic
1139636365 16:68260719-68260741 GTCCCCTGAGGCCCCCCTAGGGG + Exonic
1140648784 16:77064574-77064596 GTGCTCTCAGGCCCTCCCTGGGG + Intergenic
1141833153 16:86520996-86521018 GACCCCTGAGGCCCTGCTTGTGG + Intergenic
1142094963 16:88234582-88234604 GTCCCCTCAGGCACCCCTGGTGG - Intergenic
1144255432 17:13462803-13462825 GTCGCCTCTGCCAGTCCTTGGGG + Intergenic
1144422782 17:15113185-15113207 GTCCCCTGGGGCCCTCACTGTGG - Intergenic
1144572527 17:16408322-16408344 GTCCTCTCTGGCCCTGTTTGAGG + Intergenic
1144624089 17:16835868-16835890 GTCCCCTTTGTCCCTCTTTGGGG - Intergenic
1144710500 17:17398653-17398675 GTCTCCTCTGTCCCTCCATGTGG + Intergenic
1144882337 17:18436851-18436873 GTCCCCTTTGTCCCTCTTTGGGG + Intergenic
1144949179 17:18984872-18984894 GGCCCCAGTGGCCCTCCATGTGG - Intronic
1145149897 17:20507535-20507557 GTCCCCTTTGTCCCTCTTTGGGG - Intergenic
1146161830 17:30564173-30564195 GTCCCCTTTGCCCCTCTTTGGGG - Intergenic
1147578234 17:41614587-41614609 GTCCCCTTTGCCCCTTTTTGGGG - Intronic
1148329767 17:46806826-46806848 CTCCCCTCTGCTCCTCCTTGGGG + Intronic
1149753908 17:59172410-59172432 GCCCACTCTGGCCAGCCTTGAGG + Intronic
1152953377 18:13507-13529 GTTCCCTCTGCCACTCCTGGGGG - Intergenic
1153718800 18:7880383-7880405 GTCTCTTCTTGCCTTCCTTGTGG - Intronic
1153820064 18:8825154-8825176 GCTCCCTCTGGCTCTGCTTGTGG - Exonic
1153820104 18:8825286-8825308 GTCCCCTCTGTACCTCCCTGGGG + Exonic
1153868627 18:9296735-9296757 GTCCACTCTGGCCATGCTTGAGG + Intergenic
1154231498 18:12559561-12559583 GTCCACTCTGGCCATGCTTGAGG - Intronic
1154334199 18:13452897-13452919 GTTGCCTCTGGCCTTCCTGGAGG - Intronic
1155654222 18:28176691-28176713 GTCCCCTCTGCTCCTTCTTCGGG - Intronic
1156242416 18:35267109-35267131 GTCCCCTCTTGGCTTCCTCGGGG + Intronic
1156651883 18:39235233-39235255 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1157624870 18:49042777-49042799 GTCCCAACTGGCCCTCAATGTGG + Exonic
1160391232 18:78534838-78534860 TTCCCCTCTGGCCCTGCCTATGG - Intergenic
1160437635 18:78863466-78863488 GGCTCCTCTGGCCCTCTCTGGGG - Intergenic
1160897098 19:1408038-1408060 GACCCCTCAGGCTCTCCTTCAGG - Intronic
1160906175 19:1452746-1452768 GGCCCCTCTGTCTCCCCTTGGGG + Exonic
1161162595 19:2769401-2769423 GTCCCCTCCGCCCCTGCTTCTGG + Intronic
1161285751 19:3467467-3467489 GTCCCCTTTGGCATTCCTTTGGG - Intronic
1162091155 19:8280826-8280848 GTCCACTCTGGCCGCGCTTGAGG - Intronic
1162093389 19:8295664-8295686 GTCCACTCTGGCCGCGCTTGAGG - Intronic
1162752058 19:12834952-12834974 GGCCCTTCTGAGCCTCCTTGGGG + Intronic
1162935847 19:13981098-13981120 TTCCCCTCTGCCCCTCCATTGGG - Intronic
1164268118 19:23640828-23640850 GTCCTTTCTGGCCTTTCTTGTGG - Intronic
1164538560 19:29105469-29105491 GGCCCCTCTGGACCTCTTAGTGG - Intergenic
1164581903 19:29439904-29439926 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1164708830 19:30339961-30339983 GTGCCCACTGGTCCTCCTTGAGG - Intronic
1164751378 19:30657537-30657559 TGCTCTTCTGGCCCTCCTTGGGG + Intronic
1165404015 19:35619070-35619092 CTCCCCTCTGGCCCTCCACAAGG - Intronic
1165846518 19:38821383-38821405 GCCCACTCTGGCCATGCTTGAGG + Intronic
1165992343 19:39823847-39823869 ATCCCCTCTTGCCCTCCCTACGG + Intergenic
1166269937 19:41707656-41707678 GTCTCCTCTTGCCCTCCAGGGGG + Intronic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1166342178 19:42144771-42144793 GCCCTCTCTGACCCGCCTTGGGG - Intronic
1166446756 19:42864855-42864877 ATCCTCTCTGCCCCTCATTGTGG - Intronic
1166453678 19:42922528-42922550 GTCCTCTCTGCCCCTCATCGTGG - Intronic
1166465939 19:43031083-43031105 GTCCTCTCTGCCCCTCATCGTGG - Intronic
1166492853 19:43274136-43274158 GTCCTCTCTGCCCCTCATCGTGG - Intergenic
1166500015 19:43333292-43333314 GTCTCCTCTTGCCCTCCAGGGGG - Intergenic
1166835307 19:45664103-45664125 GTGACCTCAGGCCCTCATTGGGG + Intergenic
1166999797 19:46739099-46739121 CTCCCCTTCGGCCCTCGTTGTGG - Intronic
1167765689 19:51480710-51480732 GTCACATCTAGCTCTCCTTGGGG - Intronic
925307625 2:2861423-2861445 GTCCATTCTGGCTCTGCTTGTGG + Intergenic
925443816 2:3910421-3910443 GTCTGCTCTGCCCCTGCTTGTGG - Intergenic
925580637 2:5406699-5406721 TTCCCCTCCGGCCCTCTGTGTGG - Intergenic
925614762 2:5734798-5734820 GTCACTTCTGGCCATCCTTCCGG - Intergenic
927996811 2:27492673-27492695 GTCCCCACTGGCCTTCCCTGAGG + Exonic
928599252 2:32887041-32887063 ATCCACTCTGGCCATGCTTGAGG - Intergenic
928688491 2:33775235-33775257 GTCCACTCTGGCCGTGCTTGAGG + Intergenic
928980117 2:37128783-37128805 GTCCCATCTGGGCCTCTATGGGG - Intronic
929865131 2:45711037-45711059 GTCCCCTGTCCCCCTCCCTGTGG + Intronic
930593337 2:53356325-53356347 GTCCACTCTGGCCGCACTTGAGG + Intergenic
932178211 2:69621969-69621991 GCCCACTCTGGCCGTGCTTGAGG + Intronic
932407022 2:71520280-71520302 GTCCTCACTGTCCCTCCTGGGGG + Intronic
932468350 2:71938314-71938336 GTCCTCTCTGGACCTGCTCGGGG + Intergenic
933139734 2:78778878-78778900 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
933491124 2:82986195-82986217 GTCCACTCTGGCCATGCCTGAGG - Intergenic
933531572 2:83518058-83518080 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
934479597 2:94622658-94622680 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
934525752 2:95050623-95050645 TTCCCCTGGGGCCCTCCTTCTGG - Intronic
934613105 2:95755151-95755173 GTGCCCCCTGCCCATCCTTGGGG + Intergenic
934647793 2:96069271-96069293 GTGCCCCCTGCCCATCCTTGGGG - Intergenic
934841167 2:97625092-97625114 GTGCCCCCTGCCCATCCTTGGGG - Intergenic
935738942 2:106129542-106129564 GTCCCTTATTGCCCTGCTTGTGG - Intronic
935866371 2:107392166-107392188 GCCCACTCTGGCCATGCTTGAGG + Intergenic
935872886 2:107469816-107469838 GTCCACTCTGGCCATGCTTGAGG - Intergenic
935922484 2:108031449-108031471 GTCCACTTTGGCCATGCTTGAGG + Intergenic
937626144 2:124046069-124046091 GTCCCCTCCTCCCCTCCCTGAGG - Intronic
938177252 2:129144715-129144737 GTCCGCCCTGGCCGTGCTTGAGG - Intergenic
938194384 2:129314155-129314177 GTCCCTTCTGCCCATCCCTGTGG - Intergenic
939745459 2:145960975-145960997 GTCTGCTCTGGCCATGCTTGAGG - Intergenic
941055800 2:160786493-160786515 GTGTCCTCTGACCCTACTTGTGG - Intergenic
941476661 2:165957542-165957564 GTCCACTCTGGCAGTGCTTGAGG - Intergenic
942540115 2:177007734-177007756 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
942949703 2:181708415-181708437 GTCCCCTCTGCATCTCCTTGTGG - Intergenic
942970311 2:181950429-181950451 GTCTCCTCTGCCCCTCCTCATGG + Intergenic
943166145 2:184328127-184328149 GCCCACTCTGGCCATGCTTGAGG - Intergenic
943941505 2:194003211-194003233 GCCCACTCTGGCCATGCTTGAGG - Intergenic
944656600 2:201881942-201881964 TTCCCCATTGGCCCTCCTTTAGG + Intronic
945744247 2:213701443-213701465 GTCCACTCTGGCCACGCTTGAGG + Intronic
946053925 2:216885135-216885157 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
946459450 2:219856192-219856214 GCTCCCTCTGCCCCTCCTTATGG + Intergenic
948408739 2:237742836-237742858 CTCCAGTCTGGCCTTCCTTGAGG + Intronic
948743735 2:240069759-240069781 GTCACCTCTGGCTGACCTTGAGG - Intergenic
948833606 2:240613208-240613230 GTCCCCTCTCCTCCTCCTTCTGG - Intronic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1169204465 20:3732333-3732355 GCCCCCACAGGCCCACCTTGGGG - Intergenic
1169630294 20:7622920-7622942 GTCCACTCTGGCGGTGCTTGAGG - Intergenic
1169893102 20:10474613-10474635 GGCCCATCTGGCCTTCCTTCTGG - Intronic
1170649432 20:18226651-18226673 ACCCACTCTGGCCCTGCTTGAGG + Intergenic
1170930816 20:20768325-20768347 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1170948947 20:20916879-20916901 CTCACCTCTGGCTGTCCTTGAGG + Intergenic
1172796673 20:37544517-37544539 GTCCCCACGGCCCCTCCATGGGG + Intergenic
1173399059 20:42708482-42708504 TTCCACACAGGCCCTCCTTGTGG + Intronic
1174462367 20:50691724-50691746 GTCCCCTCCGCCCCTCTCTGAGG - Intergenic
1175390501 20:58624358-58624380 GGCCTCTCTGGCCTTGCTTGAGG + Intergenic
1175716364 20:61256772-61256794 GTCCTCTCTGACCCTCCTCTAGG + Intronic
1175929349 20:62486332-62486354 GTCCCTGCTGGGCCTCTTTGTGG + Intergenic
1177581029 21:23021805-23021827 GTCCGCTCTGGCCGCGCTTGAGG - Intergenic
1177669721 21:24209142-24209164 GTCCACTCTGGCCATGCTCGAGG - Intergenic
1180614608 22:17119529-17119551 GCCCCCTCTGGCCCGACTCGGGG + Exonic
1180722782 22:17921823-17921845 GACCCCTCTGGCACTCGTGGAGG - Intronic
1181450622 22:23017493-23017515 GCCCACTCTGGCCCCGCTTGAGG - Intergenic
1181818749 22:25459397-25459419 CTCCCCTCTGGCCCTGCAGGTGG + Intergenic
1181851427 22:25752746-25752768 GTCCACTCTGGCCATGCTTGAGG + Intronic
1182443123 22:30375657-30375679 GCCCTCTCAGGCCCACCTTGAGG - Exonic
1183082081 22:35463130-35463152 TGCCACTCTGGCCCTGCTTGAGG + Intergenic
1183978601 22:41527085-41527107 GTCCCCTCGGGGCCTCGTTTGGG + Exonic
1185038838 22:48493992-48494014 GTCCCTGCTGGACCTCCCTGAGG + Intronic
1185058580 22:48593715-48593737 GCCCCAGCTGGCCTTCCTTGGGG - Intronic
1185370712 22:50459725-50459747 GGCTCCTCTTGCCCTGCTTGGGG - Intronic
949281424 3:2352280-2352302 GTCCACTCTGGCCGCACTTGAGG + Intronic
949503540 3:4704789-4704811 GTCCCCTCTGTGCCTCTTGGGGG + Intronic
950508026 3:13407752-13407774 GGCACCGCTGGTCCTCCTTGAGG + Intronic
950601162 3:14037084-14037106 GTCCACTCTAGCCATGCTTGAGG + Intronic
950704827 3:14773223-14773245 GTCCCATCTGGGCATCCTGGGGG - Intergenic
950728915 3:14939272-14939294 GTCCCCTCTAGCTCTCGTAGAGG - Intergenic
951207331 3:19938729-19938751 GTTCTCTCTGGCGATCCTTGGGG - Intronic
951491300 3:23272478-23272500 GTCTGCTCTGGCCACCCTTGAGG - Intronic
952076251 3:29701463-29701485 GCCCACTCTGGCCGTGCTTGAGG + Intronic
952273067 3:31851508-31851530 GTGCCTTCTGGCCCTCCTCATGG - Intronic
953096208 3:39779636-39779658 GTCCGGTCTGGCCATGCTTGAGG + Intergenic
954089396 3:48272397-48272419 GTCCGCTCTGGCCACGCTTGAGG - Intronic
954230619 3:49213913-49213935 GTCCACTCTGGCCATGCTTGAGG - Intronic
956479556 3:69660553-69660575 GTCCACTCTGGCCAGGCTTGAGG + Intergenic
957209498 3:77240558-77240580 GTCCGCTCTGGCCACGCTTGAGG - Intronic
958548654 3:95589011-95589033 GTCCACTCTGGCCATGCTTGAGG - Intergenic
958627712 3:96646866-96646888 GTTCGCTCTGGCCATGCTTGAGG - Intergenic
960487250 3:118269568-118269590 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
960991573 3:123314967-123314989 TTTCCCTCTGCCCCTCCTTCAGG + Intronic
961044108 3:123696970-123696992 GTCCCCTCTGGCCTGTCTTCGGG + Intronic
961049361 3:123733765-123733787 AATCCCTCTGGCCCTCCATGGGG + Exonic
961700865 3:128743397-128743419 GTCTGCTCTGGCCATGCTTGAGG - Intronic
961865846 3:129952991-129953013 GGCCCTTGTGGCCCTCCTTACGG - Intergenic
963535101 3:146517880-146517902 GTCCCCACCTGCCCTCCTAGAGG - Intronic
964064003 3:152559336-152559358 GTCCACTCTGGCCATGCTCGGGG + Intergenic
964138428 3:153370233-153370255 ATCCACTCTGGCCATGCTTGAGG - Intergenic
964374983 3:156041205-156041227 GCCCACTCTGGCCGTGCTTGAGG + Intronic
965965686 3:174486140-174486162 GTACCCTGTAGCCCTCCATGTGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968758244 4:2427788-2427810 CTCCCCTCTGGGCTTTCTTGAGG - Intronic
969666304 4:8559274-8559296 GTCTCCTCTCGGGCTCCTTGAGG - Intronic
970408701 4:15787179-15787201 GCCCACTCTGGCCGTGCTTGAGG - Intronic
971043411 4:22779054-22779076 GTCCACTCTGGCCGTACTTGAGG - Intergenic
971209194 4:24599590-24599612 GTCCCTCCTGGCCGTGCTTGAGG - Intergenic
971722510 4:30264576-30264598 GTCCACTCTGACCGTGCTTGAGG + Intergenic
971792420 4:31185444-31185466 GTCCACTCTGGCCACGCTTGAGG - Intergenic
972173311 4:36374816-36374838 GTCCACTCTGGCAGTGCTTGAGG + Intergenic
972361006 4:38325383-38325405 GCCCACTCTGGCCATGCTTGAGG - Intergenic
973142026 4:46781563-46781585 GTCCACTCTGGCCACGCTTGAGG + Intronic
973144325 4:46805264-46805286 GCCCACTCTGGCCCCACTTGAGG - Intronic
973764362 4:54149711-54149733 GTCCACTCTGGCCGCGCTTGAGG - Intronic
974089950 4:57300643-57300665 GCCCACTCTGGCCATGCTTGAGG - Intergenic
974436768 4:61866757-61866779 ATACCCTCAGGCCCTCTTTGAGG + Intronic
974838296 4:67275717-67275739 GCCCACTCTGGCCATTCTTGAGG - Intergenic
974839856 4:67287170-67287192 GTCCACTCTGGCCGCACTTGAGG - Intergenic
975240710 4:72055468-72055490 CTCCCCTCTCCCTCTCCTTGAGG + Intronic
975744890 4:77466272-77466294 GCCCACTCTGGCCATGCTTGAGG + Intergenic
977507678 4:97923140-97923162 GCCCACTCTGGCCATGCTTGAGG + Intronic
977641102 4:99359565-99359587 GTCCACTCTGGCCACACTTGAGG + Intergenic
978254955 4:106681928-106681950 GCCCACTCTGGCCATGCTTGAGG - Intergenic
978514541 4:109557297-109557319 GTCCGCTCTGGCCATGCTTGAGG + Intergenic
978886481 4:113772222-113772244 GTCCGCTCTGGCCATGCTTGAGG + Intergenic
978929851 4:114296574-114296596 GTCCGCTCTGGCCACACTTGAGG - Intergenic
979445739 4:120809040-120809062 GCCCGCTCTGGCCATGCTTGAGG - Intronic
979678677 4:123435843-123435865 GCCCACTCTGGCCATGCTTGAGG - Intergenic
979865147 4:125744878-125744900 GTCCACTCTGGCCACACTTGAGG + Intergenic
979949574 4:126874911-126874933 GCCCACTCTGGCCATGCTTGAGG - Intergenic
980809182 4:137853513-137853535 GTCCGCTCTGGCCGCGCTTGAGG + Intergenic
981558532 4:146022660-146022682 GGCACCTCTGGACCTGCTTGGGG - Intergenic
982758268 4:159250809-159250831 ATCCACTCTGGCCATCCTGGAGG + Intronic
982768869 4:159377985-159378007 GTCCGCTCTGGCCACACTTGAGG + Intergenic
982773629 4:159420786-159420808 GTCCACTCTGGCCCCACTTGAGG + Intergenic
983425637 4:167581449-167581471 GTCCACTCTGGCCATGCTTGAGG + Intergenic
983835460 4:172378013-172378035 ATCCACTCTGGCCATGCTTGAGG - Intronic
984266743 4:177505610-177505632 GGCCCCTCTTGCCCTCCTCTTGG - Intergenic
984728594 4:183044964-183044986 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
984918036 4:184741094-184741116 GCCCACTCTGGCCATGCTTGAGG + Intergenic
985269234 4:188178865-188178887 GTCCGCTCTGGCCACACTTGAGG + Intergenic
985323036 4:188735371-188735393 GTCCACTCCGGCCATGCTTGAGG - Intergenic
985324642 4:188754384-188754406 GCCCCCTCTGGCCGCGCTTGAGG + Intergenic
985403665 4:189615695-189615717 GCTCACTCTGGCCCTGCTTGAGG - Intergenic
985412164 4:189696128-189696150 GCCCACTCTGGCCATGCTTGAGG - Intergenic
985643400 5:1074157-1074179 GTCCCCTCAGGGCCTCGGTGGGG - Intronic
985702251 5:1380605-1380627 GTCGGCTCTGGCCGTGCTTGAGG - Intergenic
986021025 5:3802732-3802754 ATCCCATGTGACCCTCCTTGAGG + Intergenic
986285867 5:6358563-6358585 GTCCCCTCTGACCCGCCCGGTGG - Intergenic
987682986 5:21161515-21161537 GTCCTCTTTGGTCCCCCTTGTGG - Intergenic
988143127 5:27267671-27267693 GCCCACTCTGGCCATGCTTGAGG - Intergenic
988591451 5:32553242-32553264 GTCCACTCTGGCCACACTTGAGG - Intronic
989207093 5:38821783-38821805 GTCCGCTCTGGCCGCACTTGAGG + Intergenic
989559616 5:42836254-42836276 ATCCACTCTGGCCATGCTTGAGG + Intronic
989714908 5:44451553-44451575 GTCCCCTCTCTCCCTTCATGTGG + Intergenic
990512222 5:56499129-56499151 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
990869404 5:60415342-60415364 GCCCACTCTGGCCGTGCTTGAGG + Intronic
990880159 5:60530206-60530228 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
991150091 5:63357706-63357728 GTCCCCTCTAGCCTTCCATGTGG - Intergenic
992048797 5:72925378-72925400 CTCCACTCTGGCCGTGCTTGAGG + Intergenic
992803044 5:80310424-80310446 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
993202267 5:84830753-84830775 GTCCACTCTGGCCACGCTTGAGG - Intergenic
994166951 5:96618398-96618420 GTCCACTCTGGCCATGCTTGAGG + Intronic
994251597 5:97542352-97542374 GCCCACTCTGGCCGCCCTTGAGG - Intergenic
994647821 5:102491820-102491842 GCCCACTCTGGCCATGCTTGAGG - Intronic
994774521 5:104026040-104026062 GCCCCCTCTAGCCCTCCTCTGGG + Intergenic
995705758 5:114987889-114987911 TTTCCCTCTGGCCCACCTTCAGG - Intergenic
996478764 5:123949661-123949683 GTCCACTCTGGCCATGCTTGAGG - Intergenic
996567127 5:124892313-124892335 GTCCACTTTGGCCATGCTTGAGG + Intergenic
996679908 5:126220806-126220828 GTCCACTCTGGCCACACTTGGGG + Intergenic
997329266 5:133047432-133047454 GTCCACTCTGGCCATGCTCGAGG + Intergenic
997375434 5:133394240-133394262 GCCCACTCTGGCCATGCTTGAGG + Intronic
997596016 5:135107944-135107966 GGCCTCTCTGGCCACCCTTGAGG + Intronic
999284841 5:150388136-150388158 GTCCCTTCTGGGCCTCAATGTGG - Intronic
999432748 5:151538252-151538274 GTCCCTTCTAGCCCTGCCTGTGG - Intronic
1000084689 5:157879208-157879230 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1002316877 5:178349470-178349492 GTCCCCTCCGGCCCTCCGCTAGG + Intronic
1002612719 5:180432050-180432072 GTCCACTCGGGCCGTGCTTGAGG + Intergenic
1003591555 6:7441162-7441184 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1003824843 6:9942062-9942084 GTCCACTCTGGCCATGCTTGGGG + Intronic
1004250244 6:14017922-14017944 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1004607430 6:17206876-17206898 GTCCACTCTGGCCACACTTGAGG - Intergenic
1006638207 6:35475020-35475042 GTGCCCTCTGCGCCTCCTTAAGG - Exonic
1007119599 6:39369007-39369029 ACCCACTCTGGGCCTCCTTGGGG + Intronic
1007363643 6:41375164-41375186 GTTCCCTCGGGAACTCCTTGAGG - Intergenic
1008572612 6:52829659-52829681 GTCCACTCTGGCCACCCTTGAGG - Intergenic
1009667703 6:66705029-66705051 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1009872202 6:69467089-69467111 GTCCACTCTGGCCATGCTCGGGG + Intergenic
1009873111 6:69472969-69472991 GTCCACTCTGGCCATGCTTGGGG + Intergenic
1010269284 6:73903047-73903069 GTCCACTCTGGCCATGCCTGAGG + Intergenic
1010270310 6:73909875-73909897 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
1011478783 6:87773785-87773807 GTCACCTCTGGCTGCCCTTGAGG + Intergenic
1012733602 6:102911113-102911135 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1013629874 6:111976003-111976025 GTCCCCTCTGTCCCTTCTATTGG + Intergenic
1013963515 6:115928512-115928534 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1014088438 6:117373759-117373781 GTCTGCTCTGGCCATGCTTGAGG - Intronic
1014586243 6:123201845-123201867 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1016023275 6:139257988-139258010 GTCCCCTCTGGCCATCTGAGGGG + Intronic
1017017847 6:150116105-150116127 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1018861113 6:167711477-167711499 GGCTCCTCTTTCCCTCCTTGGGG + Intergenic
1018915078 6:168128169-168128191 GGCCCCTCTAGCCATCCCTGGGG - Intergenic
1020143343 7:5624338-5624360 GACCCCTCTGCCCAGCCTTGTGG - Intronic
1020375420 7:7479014-7479036 GCCCACTCTGGCCATGCTTGAGG - Intronic
1020438178 7:8188742-8188764 GTTCTCTCTTGCTCTCCTTGGGG - Intronic
1021359471 7:19692707-19692729 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1021520762 7:21537008-21537030 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1021573807 7:22090219-22090241 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1022795424 7:33727890-33727912 TACCCCTCAGGCTCTCCTTGTGG + Exonic
1023232441 7:38049663-38049685 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1024735892 7:52303390-52303412 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1025875218 7:65475558-65475580 GGCCCCTCTGTCCCTCCTCCAGG + Intergenic
1026098404 7:67364984-67365006 GTCCGCTCTGGCCACGCTTGAGG - Intergenic
1027316757 7:76990463-76990485 AGCCCCTCTGGCTCTCCCTGAGG - Intergenic
1027668683 7:81070995-81071017 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1029037867 7:97541142-97541164 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1029327446 7:99822420-99822442 GTCCACCCTGTCCCTCCATGGGG + Intergenic
1029596302 7:101539117-101539139 GCCCCATCTGTCCCTCCTTGAGG - Intronic
1029993512 7:104984186-104984208 GGCCCTTCTGCCCCTCCTAGCGG + Intergenic
1031213411 7:118859121-118859143 GTCCACTCTGGCAGTGCTTGAGG - Intergenic
1033758663 7:144418371-144418393 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1034100421 7:148445698-148445720 GTCCGCTCTGGCCACGCTTGAGG - Intergenic
1035325350 7:158062458-158062480 GCCCACTCTGGCCCTGCTTGAGG + Intronic
1035829017 8:2674748-2674770 GTCCACTCTGGCCCTGGCTGTGG + Intergenic
1036928723 8:12931775-12931797 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1037064942 8:14566709-14566731 GCCCACTCTGGCCGTACTTGAGG + Intronic
1039487664 8:37924322-37924344 CTCCCCTCTGGCTGACCTTGAGG - Intergenic
1040622310 8:49103492-49103514 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1040804277 8:51377404-51377426 GGCCACTCTGGCCGTGCTTGAGG + Intronic
1040952821 8:52953700-52953722 GCCCACTCTGGCCCAGCTTGAGG + Intergenic
1040965637 8:53078101-53078123 ATCCACTCTGGCCATGCTTGAGG - Intergenic
1041588306 8:59547008-59547030 ATCCACTCTGGCCATGCTTGAGG + Intergenic
1041604413 8:59762428-59762450 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1041623487 8:59999743-59999765 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
1042169542 8:65978253-65978275 GTCTACTCTGGCCACCCTTGAGG - Intergenic
1042335964 8:67630611-67630633 GCCCACTCTGGCCATGCTTGGGG + Intronic
1043439992 8:80268506-80268528 GCCCCCTTTGCCCCTCCTTCTGG + Intergenic
1043621100 8:82192723-82192745 GTCCACTCTTGCCGTGCTTGAGG - Intergenic
1043726046 8:83611581-83611603 GTCCACTCTGGCCACGCTTGAGG - Intergenic
1044456060 8:92394023-92394045 GTCCTCTCTGGCCGCACTTGAGG - Intergenic
1044459715 8:92429703-92429725 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1044963851 8:97556801-97556823 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
1045096152 8:98800474-98800496 GTCCACTCTGGCCACGCTTGAGG + Intronic
1045678479 8:104633358-104633380 GTCTACTCTGGCCATGCTTGAGG - Intronic
1046260382 8:111759229-111759251 GTCCGCTCTGGCCATGCTTGAGG - Intergenic
1046497700 8:115036595-115036617 GTCCACTCTGGCCATGCTTGAGG + Intergenic
1046521461 8:115331037-115331059 GTCCACTCTGGCCGTGCTTGAGG - Intergenic
1047498469 8:125425385-125425407 GTCATCTCAGGCTCTCCTTGTGG + Intergenic
1048186948 8:132250130-132250152 GTCCGCTCTGACCATGCTTGAGG - Intronic
1048738401 8:137527349-137527371 GCCCCCTCTGCCTTTCCTTGTGG - Intergenic
1049015053 8:139914241-139914263 ATGCCCTCTGGCACTCCCTGTGG - Intronic
1049156872 8:141072748-141072770 CTCCCCTCTGGACCCCCCTGTGG - Intergenic
1049378025 8:142298287-142298309 GTTCCCTCTGGCACTCTGTGTGG - Intronic
1049838921 8:144757997-144758019 GCTCCCTTTGCCCCTCCTTGGGG - Intergenic
1049857875 8:144875057-144875079 GTCCACTCTGGCTGTGCTTGAGG + Intergenic
1049944584 9:581248-581270 GCCCCCTCTGGCCGTGCTTGAGG - Intronic
1050891941 9:10835854-10835876 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1051314257 9:15810876-15810898 GTCTGCTCTGGCCATGCTTGAGG - Intronic
1051549837 9:18315803-18315825 GTCCACTCTGGCTGTGCTTGAGG - Intergenic
1051879655 9:21827026-21827048 ATCCCCTCTGACCCTCTCTGTGG + Intronic
1052576503 9:30299154-30299176 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1053142190 9:35689265-35689287 GTCCCCTCTGTCCCAGCTGGAGG - Exonic
1053475172 9:38377463-38377485 GCCCACTCTGGCCGCCCTTGAGG + Intergenic
1053785775 9:41651977-41651999 GCCACCTCCGACCCTCCTTGGGG - Intergenic
1054285494 9:63164024-63164046 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1054291308 9:63296459-63296481 GTCCACTCTGGCCACGCTTGAGG + Intergenic
1054389328 9:64600999-64601021 GTCCACTCTGGCCGCGCTTGAGG + Intergenic
1054506389 9:65915373-65915395 GTCCACTCTGGCCGCGCTTGAGG - Intergenic
1055654859 9:78441956-78441978 GTCCGCTCTGGCCATGCTCGAGG + Intergenic
1055814241 9:80185769-80185791 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1056330701 9:85518906-85518928 GCCCCCTGTGGCCTTCCTTTTGG - Intergenic
1056714811 9:89020438-89020460 CTTCCCTCTGGGCCTCCTTCAGG + Intronic
1056776919 9:89519682-89519704 GTCACCTCTGGCTGACCTTGAGG + Intergenic
1056915955 9:90746333-90746355 CTCCCTTCTGGCCGGCCTTGAGG - Intergenic
1057118093 9:92545132-92545154 GCCCACTCTGGCCGTGCTTGAGG + Intronic
1057132629 9:92664670-92664692 GTTCCCTGTGGCCCTCACTGTGG - Intronic
1057286975 9:93764551-93764573 GTCCCCTCTGTTCATCCTTGTGG + Intergenic
1058065180 9:100540600-100540622 ATCCGCTCTGGCCCTGCTTGAGG - Intronic
1058379634 9:104363374-104363396 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1059891514 9:118809689-118809711 GCCCACTCTGGCCGTGCTTGAGG - Intergenic
1060216216 9:121740021-121740043 GACCCCACTGGGTCTCCTTGAGG - Intronic
1061956838 9:133968008-133968030 TTCCACTCTGTCCCTCCATGAGG - Intronic
1062025428 9:134338127-134338149 GACACCTCTGTCCCTCCCTGTGG - Intronic
1062504976 9:136868814-136868836 GTCCCATCTGGCCCTCCATCGGG + Intronic
1203670430 Un_KI270755v1:6853-6875 GCCCACTCTGGCCATGCTTGAGG + Intergenic
1186460377 X:9743759-9743781 TGCCCCTCTGGCCTTGCTTGTGG - Intronic
1186571995 X:10724721-10724743 TTGCCATCTGGCCCACCTTGTGG + Intronic
1186652885 X:11579880-11579902 TTCTCCTCTGCCCTTCCTTGGGG - Intronic
1189095886 X:38139045-38139067 CTCACCTCTGGCCCTCCTCTAGG + Intronic
1189175231 X:38950039-38950061 GCCTCCTCTGAGCCTCCTTGGGG + Intergenic
1189467189 X:41286182-41286204 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1190790705 X:53697303-53697325 GTTCTCTCTGCCCCTCCATGTGG + Intergenic
1191105016 X:56767378-56767400 GTCCACTCTGGCCGCCCTTGAGG + Intergenic
1192149508 X:68703499-68703521 CCTCCCTCTGGCTCTCCTTGGGG + Intronic
1192251330 X:69416677-69416699 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1194340516 X:92699949-92699971 ATCCACTCTGGCCATGCTTGAGG - Intergenic
1197079027 X:122389333-122389355 GTCCACTCTGGCCATGCTGGAGG - Intergenic
1197978686 X:132193981-132194003 GCCCACTCTGGCCGTGCTTGAGG + Intergenic
1198991424 X:142519278-142519300 GTTGCTTCTGGCCTTCCTTGAGG + Intergenic
1199094911 X:143726691-143726713 GCCCACTCTGGCCATGCTTGAGG - Intergenic
1199437513 X:147828953-147828975 GTCTGCTCTGGCCGTGCTTGAGG - Intergenic
1200383483 X:155865261-155865283 GTCCGCTCTGGCCAGGCTTGAGG + Intergenic
1200873697 Y:8128990-8129012 GTCCGCTCTGGCCATGCTCGGGG - Intergenic
1201555228 Y:15260050-15260072 GCCCACTCTGGCCATACTTGAGG + Intergenic
1201729991 Y:17192727-17192749 GTCCACTCTGGCCACACTTGAGG - Intergenic
1202013819 Y:20379059-20379081 GTCTGCTCTGGCCATGCTTGAGG + Intergenic
1202100653 Y:21304042-21304064 GTCCACTCTGGCCACGCTTGAGG - Intergenic
1202243701 Y:22794932-22794954 ATCCGCTCTGGCTCTGCTTGAGG + Intergenic
1202396688 Y:24428682-24428704 ATCCGCTCTGGCTCTGCTTGAGG + Intergenic
1202474095 Y:25241410-25241432 ATCCGCTCTGGCTCTGCTTGAGG - Intergenic