ID: 1119554477

View in Genome Browser
Species Human (GRCh38)
Location 14:75542667-75542689
Sequence TAAGTGTCAGGCTGGCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119554472_1119554477 7 Left 1119554472 14:75542637-75542659 CCTGCAAGGGAAGTCAAACCCTT 0: 1
1: 0
2: 1
3: 5
4: 103
Right 1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG 0: 1
1: 0
2: 1
3: 19
4: 191
1119554467_1119554477 25 Left 1119554467 14:75542619-75542641 CCAGATCAGCCACTTCCTCCTGC 0: 1
1: 0
2: 2
3: 38
4: 352
Right 1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG 0: 1
1: 0
2: 1
3: 19
4: 191
1119554470_1119554477 16 Left 1119554470 14:75542628-75542650 CCACTTCCTCCTGCAAGGGAAGT 0: 1
1: 1
2: 4
3: 31
4: 272
Right 1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG 0: 1
1: 0
2: 1
3: 19
4: 191
1119554471_1119554477 10 Left 1119554471 14:75542634-75542656 CCTCCTGCAAGGGAAGTCAAACC 0: 1
1: 0
2: 1
3: 2
4: 92
Right 1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG 0: 1
1: 0
2: 1
3: 19
4: 191
1119554466_1119554477 26 Left 1119554466 14:75542618-75542640 CCCAGATCAGCCACTTCCTCCTG 0: 1
1: 0
2: 3
3: 56
4: 338
Right 1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG 0: 1
1: 0
2: 1
3: 19
4: 191
1119554465_1119554477 27 Left 1119554465 14:75542617-75542639 CCCCAGATCAGCCACTTCCTCCT 0: 1
1: 0
2: 6
3: 58
4: 430
Right 1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG 0: 1
1: 0
2: 1
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119554477 Original CRISPR TAAGTGTCAGGCTGGCTGCA CGG Intronic
900271685 1:1793354-1793376 TATGTATGAGGCTGGGTGCAAGG - Intronic
903008502 1:20314298-20314320 TAAGTGCCAGGCTGGCGTCAGGG - Intronic
903386481 1:22930353-22930375 TATGTGCCAGGCTGTCTGCTGGG - Intergenic
905629522 1:39510954-39510976 TCAGGGTGAGCCTGGCTGCAGGG + Intronic
905668238 1:39775236-39775258 TCAGGGTGAGCCTGGCTGCAGGG - Intronic
906688441 1:47777485-47777507 TAAGTGGCAGTCTGGCTCCAGGG - Intronic
911744865 1:101430218-101430240 TTAGTTTTAGGCTGGGTGCAGGG - Intergenic
912506787 1:110162037-110162059 TAAGTGACAAGCTGGCACCAAGG + Intronic
912625891 1:111204311-111204333 TCAGTCTCAGGCTGGCTCGAAGG + Intronic
913168840 1:116213614-116213636 TGAGTGTCGGGCTGTCTGGAGGG - Intergenic
914859082 1:151371947-151371969 TCCATGTCAGGCTGGCTGCTGGG + Intronic
915493420 1:156264669-156264691 TAAGTGACAGGCTGGGAGCAAGG + Intronic
915598865 1:156910086-156910108 TCAGTGCCAGGCTGGCTGGATGG + Exonic
916267014 1:162900568-162900590 TAGGTGTGTAGCTGGCTGCATGG - Intergenic
916958679 1:169866751-169866773 TATGTGTCAGGCTTTCTGCTAGG - Intronic
920403692 1:205693439-205693461 CAAGTGGTGGGCTGGCTGCACGG + Intergenic
922321844 1:224495465-224495487 TAGGTGTCAGGCTAGGTGCTGGG + Intronic
923151134 1:231234433-231234455 TAAGTGCAAGGCTGCCTGTAAGG - Intronic
924145201 1:241067318-241067340 TAAATGTCAGGCTAGGAGCATGG - Intronic
1063830130 10:9942886-9942908 CCAGTCTCAGCCTGGCTGCAGGG + Intergenic
1064029722 10:11876105-11876127 TGAGTGTGAGGATGGCAGCAAGG + Intergenic
1064345937 10:14532983-14533005 AAAGCGCGAGGCTGGCTGCAGGG + Intronic
1067090990 10:43265870-43265892 CAGGAGTCAGGCTGGGTGCAGGG - Intronic
1069160308 10:65084406-65084428 GAAGTGGCAGGCTGGCCACAAGG + Intergenic
1069596733 10:69676780-69676802 TAAGTGCCAGGCAGCCTTCAAGG - Intergenic
1070321110 10:75355380-75355402 TAAGTGGCAAGCTTGATGCAAGG - Intergenic
1072952329 10:99858669-99858691 GACCTGTCAGGGTGGCTGCAGGG + Intergenic
1073191262 10:101651904-101651926 TGATTGGCAGGCGGGCTGCAGGG - Intronic
1074661190 10:115659455-115659477 TAAGTGTCAGGCAGTCTCCTGGG + Intronic
1076066829 10:127455374-127455396 TAAGTGTCCACCTGGCTGGACGG + Intergenic
1076288792 10:129327810-129327832 TGGGTGTCCTGCTGGCTGCATGG - Intergenic
1076619455 10:131777980-131778002 TAGATGGCAGGCTGGCTTCATGG + Intergenic
1077631041 11:3811197-3811219 TGAGTGCCAGCCTGGCTGCCTGG + Intronic
1078920656 11:15827113-15827135 TAAGTGGAGGGCTGGATGCAAGG + Intergenic
1081157065 11:39706055-39706077 TAAGTGCTAGGCTGACTGGATGG - Intergenic
1084507282 11:69576134-69576156 TCAGTGCCAGGCTGGTTGCGGGG + Intergenic
1086878573 11:92127581-92127603 TAAGTGTCAGGCTAGGGGCCAGG + Intergenic
1089667978 11:120032399-120032421 TAGGTGGCAGGCAGGCAGCAAGG - Intergenic
1089673508 11:120073411-120073433 CATCTGTCAGGCCGGCTGCAAGG + Intergenic
1089697659 11:120225901-120225923 TTAGAGCTAGGCTGGCTGCAGGG - Intronic
1089730871 11:120517930-120517952 TAAGTGAGAGGCTGACTGCAAGG + Intronic
1090771410 11:129922851-129922873 TGAGCGTCCTGCTGGCTGCAAGG + Intronic
1091731593 12:2885069-2885091 TAAGTGTCATGCTGGGTGCTGGG - Intronic
1093662702 12:21775044-21775066 TGTGTGTCACGCTGGCGGCAGGG - Intronic
1094396033 12:30006621-30006643 GTAGTGTCAGGCAGGCTACAGGG + Intergenic
1094472911 12:30819886-30819908 GTAGTCTCAGGCTGGCTGGAGGG - Intergenic
1094619843 12:32069548-32069570 AAAGTGTGAGGGTGGCTGTATGG - Intergenic
1096857147 12:54492007-54492029 TAAGTGTCAAGGTGGCATCAAGG - Intergenic
1099973209 12:89521737-89521759 TAAGTGCCAGGCTCGGTGCTAGG + Exonic
1100312476 12:93409711-93409733 TAGTTGTCAGGTTAGCTGCAGGG - Exonic
1104061155 12:125269692-125269714 TATGTGTTAGGTTGGCTGCAGGG + Intronic
1107250167 13:38350244-38350266 TAAGTGTCAGCTTGGCAGCTTGG + Intronic
1110558688 13:76886987-76887009 TATTTTCCAGGCTGGCTGCAAGG - Intergenic
1112955330 13:105050977-105050999 TAAGGCTCTGGCTGGCTGAAAGG + Intergenic
1119554477 14:75542667-75542689 TAAGTGTCAGGCTGGCTGCACGG + Intronic
1119953805 14:78773393-78773415 GGAGTGTCAGCCAGGCTGCATGG + Intronic
1120380857 14:83777594-83777616 TAAGCTGCAGGCTGGCTGGATGG + Intergenic
1121900811 14:97692028-97692050 TGGGTGTCAGCCTGGCTGAATGG + Intergenic
1122014646 14:98784313-98784335 TAAGTGACAGGCTGGCAGAGTGG + Intergenic
1122203340 14:100135937-100135959 TAGGTGGCTGGCTGGCTGCTCGG - Exonic
1123109959 14:105862261-105862283 TTAGAGTCAAGATGGCTGCATGG - Intergenic
1124591860 15:31060947-31060969 TCACTGTCAGGCTGGCTGCCTGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126263858 15:46729268-46729290 TAAGTGTCTCCCTGCCTGCAGGG + Intergenic
1126844588 15:52746918-52746940 TAACTGTCAGAATAGCTGCAGGG - Intergenic
1127065122 15:55229279-55229301 TAACTGACAGGCAGGCTCCAGGG + Intronic
1128369369 15:67029118-67029140 TATGTGGCAGGCTGTCAGCAAGG + Intergenic
1128764339 15:70241962-70241984 TGAGTCTCAGGATGGCTGCAGGG + Intergenic
1129429366 15:75487687-75487709 TAAGAGACTGGCTGGCTGGAGGG - Intronic
1129527755 15:76232411-76232433 TTAGTGTCAGTCTGGTTACATGG - Intronic
1130058867 15:80555220-80555242 TATGTGCCAGGCAGGCTGCAAGG + Intronic
1130194331 15:81764816-81764838 GATGGGTCAGGCTGGTTGCAAGG - Intergenic
1130672755 15:85927166-85927188 TAGGTGTCAGGATGTCTTCAAGG - Intergenic
1130730177 15:86483601-86483623 TCAGTTTCAGGCTTGCTCCAAGG + Intronic
1134097124 16:11425206-11425228 CCAGAGCCAGGCTGGCTGCATGG + Exonic
1134814407 16:17194168-17194190 CAAGTGTCCGGCAGGCTGCTAGG + Intronic
1135220616 16:20611666-20611688 TAAATGAAAGACTGGCTGCATGG + Intronic
1136294112 16:29291987-29292009 TAAGTGCCAGGCTTCCTGGAGGG + Intergenic
1137973919 16:53014240-53014262 GTTGTGTCAGCCTGGCTGCAGGG + Intergenic
1140192459 16:72829487-72829509 TAAGTGCCAAGCTGTGTGCAAGG - Intronic
1142100015 16:88266033-88266055 TAAGTGCCAGGCTTCCTGGAGGG + Intergenic
1142587097 17:980256-980278 TAAGGGTCAGGCTTCGTGCAGGG - Intergenic
1142692402 17:1614678-1614700 TAAGAACCAGGCCGGCTGCAGGG - Intronic
1143014764 17:3885763-3885785 TGGGTGTCAGGCTGGCTACCAGG + Intronic
1146055150 17:29577259-29577281 AAAGGGCCAGGCTGGCTTCAGGG + Intronic
1146372309 17:32272762-32272784 TATGTGTCAGGCAGGCAGCCAGG - Intronic
1146783241 17:35695094-35695116 TATCTGTCAGGCAGGCTGAAAGG + Intronic
1147505153 17:41008893-41008915 TAGGTATCAGGCTTGCAGCAGGG + Exonic
1149667671 17:58377225-58377247 TAAGTGTCAGGCTTTTTGCTAGG - Intronic
1150627379 17:66850084-66850106 CAAGGGGCAGCCTGGCTGCAGGG - Intronic
1151570365 17:74922802-74922824 TAAGGGTCCGCCTGTCTGCAGGG + Intronic
1153106731 18:1536606-1536628 TAACTTTCAAGCTGACTGCATGG + Intergenic
1153408931 18:4771611-4771633 TAGGTGTCTGGCTTGCTGAATGG - Intergenic
1156204416 18:34870695-34870717 CTGGTGTCAGGCTGGCTGCTGGG - Intronic
1157481737 18:48059690-48059712 TAAGTGTCAGGAAAGCTGAAAGG - Intronic
1157505106 18:48220466-48220488 TAAGTGTCAGGCATGGTGCTGGG + Intronic
1158626899 18:59079409-59079431 AAGGTGGCATGCTGGCTGCATGG + Intergenic
1159378581 18:67627369-67627391 TATGTGTCAGACTGTATGCAGGG + Intergenic
1159400017 18:67919008-67919030 TAAGTGCCAGCCTGGCTCCTTGG - Intergenic
1159570144 18:70103218-70103240 GAAGTGACAGCCTGTCTGCAGGG + Intronic
1165273616 19:34731232-34731254 CAGGTGTCAGCCTGGCCGCAGGG + Intergenic
927278934 2:21286793-21286815 AATGTGACAGGCTGGCTTCAGGG + Intergenic
929751459 2:44718412-44718434 TAAGTGAATGGATGGCTGCATGG - Intronic
936091637 2:109505209-109505231 CAGGTGTCAGGCTGGCTGATTGG - Intergenic
936245134 2:110820028-110820050 TGAGTGTCAGGCACGGTGCAAGG - Intronic
937362348 2:121237911-121237933 AAAGTGCCAGGCTGGGTGCCGGG - Intronic
938208681 2:129445520-129445542 TCAGGGACAGGCTGGCAGCAGGG + Intergenic
938995816 2:136676574-136676596 CAAGTGTCAGCCTTGCTGAAGGG + Intergenic
941105103 2:161343240-161343262 AAAGTGGAATGCTGGCTGCAAGG - Intronic
941413617 2:165191265-165191287 TGGGAGTCAGGCTGGCAGCAGGG - Intronic
945407453 2:209467076-209467098 TTAGAGTCTGGGTGGCTGCATGG - Intronic
945550318 2:211213530-211213552 TACCTGTCAGGGTGGATGCAAGG + Intergenic
1170162884 20:13333172-13333194 TACATGCCAGGCTGGCTGCATGG - Intergenic
1170464208 20:16608161-16608183 AAAGAGACAGGCTAGCTGCAGGG - Intergenic
1172368024 20:34364374-34364396 TAAGTGGGTGGCTGGCTCCAGGG - Intronic
1172632226 20:36386158-36386180 TCTGTGTCCTGCTGGCTGCATGG - Intronic
1173593925 20:44247095-44247117 TCAGTGTCAGGCTCCCTGCAAGG - Intronic
1174052096 20:47774051-47774073 TAAGTGTCGGGCTGTTTCCAAGG - Intronic
1176305041 21:5118865-5118887 CACGGGTCAGGCAGGCTGCATGG + Intronic
1177915203 21:27080747-27080769 AAAGTGGCAGGCTGGGTGGAGGG + Intergenic
1179852014 21:44143165-44143187 CACGGGTCAGGCAGGCTGCATGG - Intronic
1179990860 21:44947687-44947709 TAAGGGTAAGGCAGGCTCCAGGG - Intronic
1180134349 21:45852342-45852364 CAAAAGTCAGGGTGGCTGCAGGG - Intronic
1180134380 21:45852537-45852559 CAAAAGTCAGGGTGGCTGCAGGG - Intronic
1181403460 22:22665767-22665789 TGAGGGTCAGGCAGGCAGCAGGG - Intergenic
1182141087 22:27959001-27959023 TAAGTATCATGCTGGCTTCAGGG - Intergenic
1182317885 22:29459954-29459976 CAAGTGTCAGACTGCCTGAAGGG + Intergenic
1183499105 22:38167807-38167829 AAAGTGTCAGGCTGGGGGCCAGG - Intronic
1183874777 22:40770638-40770660 TAATTGTCATGCTGGCTGGTTGG - Exonic
1184651578 22:45921625-45921647 CAGGGGTCAGGCTGGCTCCAGGG + Exonic
1184789085 22:46688213-46688235 TAAGTGACAGGCTGTTTCCATGG + Intronic
1184848394 22:47103109-47103131 AAAGGGACAGGCTGGGTGCATGG - Intronic
1184911304 22:47536043-47536065 AAAGAGCCAGGCTGGCTGGAAGG - Intergenic
1185330442 22:50249836-50249858 TGTGTGCCAGGCTGGCTGCAGGG - Intronic
950054786 3:10015790-10015812 CTGGTGTCAGGCTGGCTCCATGG - Intergenic
952041799 3:29269872-29269894 AAAGTGTCAGGCAGGCTGTATGG + Intergenic
953022987 3:39127697-39127719 AAAGTGCCAGCCTGTCTGCAGGG + Intronic
955197886 3:56822292-56822314 TCTGGGTCAGGCTGGCTCCAGGG + Intronic
962700903 3:137999097-137999119 CAGGTGTCTGGCTGGCTGGAGGG + Intronic
965024178 3:163277510-163277532 TAGGTGTGTGCCTGGCTGCATGG - Intergenic
965305826 3:167061896-167061918 TGGATGTCAGGCTGGCTTCATGG - Intergenic
967365983 3:188687024-188687046 TCAATGTCAGGCTGTCTGAAAGG + Intronic
967727967 3:192879605-192879627 TAAGTGGCAGGTTGGAAGCAGGG + Intronic
967950467 3:194836493-194836515 GCAGAGACAGGCTGGCTGCATGG + Intergenic
968135222 3:196215832-196215854 TATGTGTCAGGCTGCGTGCCAGG + Intronic
969522967 4:7689478-7689500 CAGGTGGCAGTCTGGCTGCAAGG - Exonic
971347386 4:25823739-25823761 AAAGTGTCAGGCAGGCTGCCAGG + Intronic
972199102 4:36691906-36691928 TCAGAGTTAGGCTGGGTGCAGGG + Intergenic
976471711 4:85436593-85436615 TAAGTCTCAGGCTTGGTGGAGGG - Intergenic
977175006 4:93809013-93809035 TAAGAGTCAGGTTGGCATCAGGG - Intergenic
977807022 4:101312554-101312576 TTATTGTCAGACTGGCTGAATGG + Intronic
977914698 4:102578434-102578456 TATGTGCCAGGCTGTCTGCTTGG + Intronic
982510246 4:156273687-156273709 TTAGTATGATGCTGGCTGCAGGG + Intergenic
984465307 4:180093061-180093083 TAAGTGTCAGTGTGACTGAAAGG - Intergenic
984765332 4:183396356-183396378 TCTGAGTCAGGCTAGCTGCATGG + Intergenic
990551063 5:56879150-56879172 TAGGTGTGAGGCTTGCTGCGAGG - Intronic
995803557 5:116026078-116026100 TAAGTGCCAGGATAGCTGCGTGG + Exonic
997640613 5:135446505-135446527 GAACCGTCAGGCTGGCTTCAGGG - Exonic
997693057 5:135840222-135840244 TAGGTGTCAGGCTCTCTGCTAGG + Intronic
1001453404 5:171843103-171843125 GAAGTGGGAGGCTGGCTGCTGGG - Intergenic
1001894331 5:175365554-175365576 CGAGAGTCAGTCTGGCTGCATGG - Intergenic
1002971546 6:2027260-2027282 TCTGTGTGAGACTGGCTGCATGG + Intronic
1003117685 6:3294067-3294089 TCAGTGTCAGGCTAGCCCCAGGG - Intronic
1003989775 6:11474215-11474237 TCAGTGTCAGGCTAGTTGCAAGG - Intergenic
1004132823 6:12937171-12937193 TCTGTGTTAGGCTAGCTGCATGG + Intronic
1005228226 6:23668163-23668185 TAAGTATAATGTTGGCTGCAGGG + Intergenic
1005954787 6:30656332-30656354 TAGGGGTCAGGATGGCTCCAGGG - Intronic
1006585967 6:35112982-35113004 TAACTGTCAGGCTGGAGGCTGGG + Intergenic
1006882339 6:37351299-37351321 TAAATGTCAGGGTGGCTTCTAGG + Intergenic
1007180125 6:39923620-39923642 TAAAAGGCAGGCTGGCTGCCAGG - Intronic
1013812137 6:114057370-114057392 TAAGTGCCTGGCGGGCAGCAAGG - Exonic
1014770174 6:125451171-125451193 CAAGTGTTAGGCTGGCTGCATGG + Intergenic
1016984130 6:149881597-149881619 TGGCTGGCAGGCTGGCTGCAGGG + Intergenic
1019481733 7:1270120-1270142 TAAGTGCCAGGCAGGCTGGGCGG + Intergenic
1020093572 7:5355127-5355149 TAAGTTTGTGGCTAGCTGCAGGG - Intronic
1021274652 7:18635115-18635137 TAATTGTCAGGCAGTGTGCACGG - Intronic
1023168347 7:37365287-37365309 CAATTCCCAGGCTGGCTGCAGGG + Intronic
1029110174 7:98210089-98210111 TGAGTGTCACGCTGGCTGGCAGG - Intergenic
1029705545 7:102273934-102273956 CACGTGGCAGGCTGGTTGCAGGG + Intronic
1030372498 7:108716387-108716409 TATGTGTCAGGCAGGTTCCAGGG + Intergenic
1036765757 8:11548374-11548396 AAAGAGTCAGGAGGGCTGCATGG - Intronic
1037001103 8:13719781-13719803 TACGTGTCAGGTTTTCTGCAGGG - Intergenic
1039552216 8:38451393-38451415 TGCGTTTCAGCCTGGCTGCAGGG - Intronic
1039736636 8:40339668-40339690 CAAGTGTCAGGATGGCTGAGTGG - Intergenic
1039762650 8:40594121-40594143 TCAGTGTCAGGCTGGCGGAGGGG - Intronic
1041392026 8:57355302-57355324 TAAGGGGCAGGCTGACTCCAGGG + Intergenic
1042482296 8:69317904-69317926 TAAGAATCAGGCTGGATGCTGGG + Intergenic
1044187686 8:89275511-89275533 TAAGTGTCAGTGTGTGTGCATGG - Intergenic
1045248105 8:100460693-100460715 TATGTGTCAGGTTGGATGCCAGG + Intergenic
1047210983 8:122840076-122840098 TAAGTGCCAGGCTAGCTCCAGGG + Intronic
1048344545 8:133566839-133566861 GAACTTGCAGGCTGGCTGCAAGG + Intronic
1051340065 9:16102782-16102804 TAGGTGTCAGGCAGTCAGCATGG + Intergenic
1053414463 9:37938316-37938338 TCAGTGAAAGGGTGGCTGCATGG - Intronic
1053433326 9:38058391-38058413 GAAGAGCCAGGATGGCTGCAGGG - Intronic
1055114384 9:72591241-72591263 TAAACATCAGTCTGGCTGCAAGG + Intronic
1057705878 9:97394654-97394676 CCATTGTCAGGCTGGATGCAGGG + Intergenic
1059147529 9:111913987-111914009 GAAGTGTCAAGCAGTCTGCATGG - Intronic
1059539108 9:115112960-115112982 CAGGTCTCAGGCTGGTTGCAGGG + Intronic
1059615408 9:115945272-115945294 TAAGTGCCTGGCTGGGTGCCTGG - Intergenic
1059653214 9:116334494-116334516 TGAGTTTCAGGCTGCCTGCCTGG - Intronic
1060942711 9:127552171-127552193 TCAGTGTCAGGCTGTGTGCTGGG - Intronic
1061081356 9:128372480-128372502 TCAGTGTCTGGCTTGCTGCCCGG - Intronic
1062649740 9:137569434-137569456 TGAGTGACTGGCTGGCTGGATGG - Intronic
1185759696 X:2681040-2681062 TAAATGGCTGGCTGGCTGGATGG - Intergenic
1187950530 X:24465737-24465759 TAAGTCCCAGGCTGGGTGCGAGG - Intronic
1189884387 X:45526020-45526042 TTAGTGTCAGGATGGCTGAGTGG + Intergenic
1191866044 X:65704716-65704738 TAAATGTCAGGCTGGCACTATGG + Intronic
1191897730 X:66011422-66011444 TAAGTGTCAGGCATGGTGCAAGG - Intergenic
1195840677 X:109172678-109172700 TAAGTCTCATGCCTGCTGCATGG - Intergenic
1195899452 X:109782201-109782223 GAAGTGGCAGGCTGGGGGCAGGG + Intergenic
1199107286 X:143884868-143884890 TAGTTGTCAGGTTAGCTGCAAGG + Intergenic
1202114540 Y:21458110-21458132 TATGTGGGAGGCTGGCTGTAAGG + Intergenic