ID: 1119555328

View in Genome Browser
Species Human (GRCh38)
Location 14:75548269-75548291
Sequence CTGTCCCTCTAAAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119555328_1119555341 26 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555341 14:75548318-75548340 ATCCCTCATGGGGTGACAGAAGG No data
1119555328_1119555332 2 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555332 14:75548294-75548316 TCTGCCTGCTGCCTCCCCGGTGG No data
1119555328_1119555335 14 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555335 14:75548306-75548328 CTCCCCGGTGGCATCCCTCATGG No data
1119555328_1119555336 15 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555336 14:75548307-75548329 TCCCCGGTGGCATCCCTCATGGG No data
1119555328_1119555345 30 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555345 14:75548322-75548344 CTCATGGGGTGACAGAAGGGAGG No data
1119555328_1119555338 16 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555338 14:75548308-75548330 CCCCGGTGGCATCCCTCATGGGG No data
1119555328_1119555342 27 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555342 14:75548319-75548341 TCCCTCATGGGGTGACAGAAGGG No data
1119555328_1119555330 -1 Left 1119555328 14:75548269-75548291 CCATTTGTCCTTTAGAGGGACAG No data
Right 1119555330 14:75548291-75548313 GCCTCTGCCTGCTGCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119555328 Original CRISPR CTGTCCCTCTAAAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr