ID: 1119557722

View in Genome Browser
Species Human (GRCh38)
Location 14:75566440-75566462
Sequence AGTCCTGGTGGCACACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119557722_1119557727 25 Left 1119557722 14:75566440-75566462 CCAGCTTGTGTGCCACCAGGACT No data
Right 1119557727 14:75566488-75566510 AAGTACTTTTGTGTTTGTTGTGG No data
1119557722_1119557726 -4 Left 1119557722 14:75566440-75566462 CCAGCTTGTGTGCCACCAGGACT No data
Right 1119557726 14:75566459-75566481 GACTGTGAAGAGATGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119557722 Original CRISPR AGTCCTGGTGGCACACAAGC TGG (reversed) Intergenic
No off target data available for this crispr