ID: 1119557790

View in Genome Browser
Species Human (GRCh38)
Location 14:75566912-75566934
Sequence CTGAGCAGAGGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119557782_1119557790 -8 Left 1119557782 14:75566897-75566919 CCCGGTCCCAAGGGGCTGAGCAG No data
Right 1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG No data
1119557776_1119557790 10 Left 1119557776 14:75566879-75566901 CCCACTGGGTGAGGGAGTCCCGG No data
Right 1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG No data
1119557775_1119557790 13 Left 1119557775 14:75566876-75566898 CCGCCCACTGGGTGAGGGAGTCC No data
Right 1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG No data
1119557778_1119557790 9 Left 1119557778 14:75566880-75566902 CCACTGGGTGAGGGAGTCCCGGT No data
Right 1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG No data
1119557783_1119557790 -9 Left 1119557783 14:75566898-75566920 CCGGTCCCAAGGGGCTGAGCAGA No data
Right 1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119557790 Original CRISPR CTGAGCAGAGGGAAGGAGGA AGG Intergenic
No off target data available for this crispr