ID: 1119566458

View in Genome Browser
Species Human (GRCh38)
Location 14:75633244-75633266
Sequence CAGGGTCATCAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119566454_1119566458 -10 Left 1119566454 14:75633231-75633253 CCTCAAGAAGGGGCAGGGTCATC 0: 1
1: 0
2: 0
3: 12
4: 263
Right 1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG 0: 1
1: 0
2: 2
3: 47
4: 645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119566458 Original CRISPR CAGGGTCATCAGGAAGAGGA GGG Intronic
900595515 1:3478537-3478559 CAGGGTCACCTGGAAGGGGTGGG - Exonic
900605532 1:3521950-3521972 CAGGGACTTCAGGGAGAGGAAGG + Intronic
900650315 1:3727191-3727213 CAGGGTGATGATGATGAGGATGG - Exonic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901224754 1:7606803-7606825 AAGGATCATCAGGGTGAGGAGGG + Intronic
901376201 1:8841275-8841297 CAGGGCCCTCAGGCAGAGGCTGG - Intergenic
901753643 1:11427663-11427685 TAGGGACAACAGGAAGAGGTGGG - Intergenic
901941526 1:12666020-12666042 CAGGGCCTTCAGGAAGTGAATGG - Exonic
901948818 1:12725281-12725303 CAGGGACTTCAGGAAGTGGATGG - Exonic
901959637 1:12814997-12815019 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
902372685 1:16015987-16016009 CAGGGACATGGGGAAGAGGTGGG + Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903017723 1:20372108-20372130 CTGAGTCATCAGGAAGATGTAGG - Intergenic
903266796 1:22162712-22162734 CAGTGTCCGCAGGAAGGGGATGG + Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903333229 1:22608211-22608233 CAGGGGCAGAAGGGAGAGGAAGG - Intergenic
903375310 1:22862109-22862131 CAGGGCCAGCAAGAAGAGGAAGG + Intronic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
904818172 1:33220985-33221007 AAGGGTCAGCAGAAAGAGGGTGG + Intergenic
904955875 1:34283465-34283487 CAGGGACCTGAGGAAGATGAGGG - Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
906126869 1:43432298-43432320 CAGGGTCTTCAAGAAGAACATGG - Exonic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
906568018 1:46814210-46814232 CCAGGTCATCAGGGAGCGGAAGG + Exonic
907293963 1:53437720-53437742 CAGCAACATCAGGAAGAGAAGGG + Intergenic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
909736291 1:78966647-78966669 CAGGCCCACCTGGAAGAGGAGGG - Intronic
909917465 1:81337486-81337508 CACGGTCTTCATGAAGGGGATGG - Intronic
911038610 1:93574789-93574811 AAGTCTCATCAGGAAGAGCAGGG + Intronic
912170980 1:107098776-107098798 CAGGGTCACCAGGCAGTGCAGGG - Intergenic
912179972 1:107208021-107208043 CACGATCATGATGAAGAGGAGGG - Intronic
912262221 1:108121634-108121656 CAGGAGCCTCAGGAAGGGGAGGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
914996721 1:152549784-152549806 CAGGGTAATCAGGCAGGAGAAGG - Intronic
915003565 1:152615597-152615619 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
915625090 1:157109550-157109572 CAGGGCCTTCCTGAAGAGGAGGG - Intergenic
915809341 1:158890113-158890135 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
916354891 1:163893916-163893938 CAGAGTTTTCAGGAAGAGAAAGG + Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917984702 1:180304254-180304276 CAGGGTAATCAGGCAGGAGAAGG + Intronic
918469639 1:184858781-184858803 AAAGGCCATCAGGAAGAGAATGG + Intronic
918817792 1:189211529-189211551 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
919612214 1:199759421-199759443 AGGGGGCACCAGGAAGAGGAAGG + Intergenic
919910268 1:202106770-202106792 CAGGGTCCTCAGGCTGAGGGCGG - Intergenic
920233927 1:204490193-204490215 GAGAGTTCTCAGGAAGAGGAAGG + Exonic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
921144487 1:212340193-212340215 CTGGATCCTCAGGAAGAGGATGG - Intronic
922088065 1:222369762-222369784 CAGGGTCTCCAGGAAGAGTCAGG + Intergenic
922150295 1:222996528-222996550 CAGAGTCTTCAGGAAAGGGAAGG - Intronic
922374008 1:224942498-224942520 CAGGGCAATCAGGCAGAAGAAGG - Intronic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
923068988 1:230545646-230545668 CCTGATCATCAGGAAGAGGCAGG + Intergenic
923161077 1:231315676-231315698 CATGGTCCTTACGAAGAGGATGG - Intergenic
924168017 1:241305665-241305687 CAAGTTCATCAGGAAAAGGGTGG - Intronic
924859832 1:247909862-247909884 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1064921820 10:20527707-20527729 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1065418623 10:25517365-25517387 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1065661039 10:28004421-28004443 CTGGATCATCAGGAAGAGGGAGG - Intergenic
1065904467 10:30237871-30237893 CAGGGTCAGAAGGAAGGAGATGG + Intergenic
1067508773 10:46877964-46877986 CAGGTGCAACAGGAAGATGAAGG + Intergenic
1067653476 10:48173886-48173908 CAGGTGCAACAGGAAGATGAAGG - Intronic
1067842066 10:49688879-49688901 AAGGGAGATCAGGAAGAGGGAGG - Intronic
1068165534 10:53327394-53327416 AACAGTCATCAGCAAGAGGAGGG - Intergenic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1069757605 10:70782712-70782734 TAGCGTCCTCAGGAAGGGGAGGG - Intronic
1069883622 10:71609531-71609553 CAGAGAGCTCAGGAAGAGGAAGG - Intronic
1070385163 10:75917630-75917652 CAGGGTGATAAGAAAGAGCAAGG + Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070845702 10:79521337-79521359 CTGTGTCATCAGGCAGAAGAAGG - Intergenic
1071517878 10:86311015-86311037 CATGGGCAGGAGGAAGAGGAGGG + Intronic
1072449716 10:95530275-95530297 CAGGGTCCTCTGGGAGAGGTAGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1073250830 10:102119634-102119656 CAGGGTCCTCAGAAACAGCATGG + Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1074179608 10:111047271-111047293 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1075491161 10:122870933-122870955 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1075894694 10:125984637-125984659 CAGAGTCATCAGCATGAGGCTGG + Intronic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077697006 11:4402800-4402822 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1078413420 11:11146525-11146547 CAGGGACTTGAGGAAGAGGGTGG - Intergenic
1078543760 11:12231449-12231471 CAGGTGGCTCAGGAAGAGGAGGG - Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079131724 11:17750628-17750650 CAGGGTGATCTGGAATAGCAGGG - Intronic
1080291662 11:30677931-30677953 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1082112079 11:48288167-48288189 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082135441 11:48543899-48543921 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1082247894 11:49946072-49946094 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082599942 11:55136839-55136861 CAGGGCCATCAGGCAGGAGAAGG + Intergenic
1083063402 11:59898252-59898274 CAGGGTCAGCAGGAAGGCGGCGG - Intergenic
1083758534 11:64803706-64803728 CAGTTTCGTCAGGAAGAGGGCGG + Exonic
1083855380 11:65390615-65390637 CCGGGGCAGCAGGAAGAGGGTGG - Intronic
1083994587 11:66265819-66265841 CAGGGGCATCAGGCAGTGAATGG - Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084276347 11:68053069-68053091 CAGGGGCATCAGGAAAGGTAAGG + Exonic
1085056119 11:73405030-73405052 CAGGCTCATCTGGGAGAAGAGGG - Intronic
1085174064 11:74471409-74471431 CAGGTCCTTCAGGAAGAAGATGG - Intergenic
1085366029 11:75945716-75945738 CAGGGTCATATGGGAGAGGATGG - Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1088812111 11:113399063-113399085 CTGGGCCACCAGGAAGTGGAGGG - Exonic
1089353798 11:117836873-117836895 CATGGTCAGAGGGAAGAGGAAGG - Intronic
1089603933 11:119630768-119630790 CAGGGGCAGAAGGAAGGGGAAGG + Intronic
1089679702 11:120112361-120112383 CAGGGTCAGGAGGAAGAGCAGGG + Exonic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1090101863 11:123805938-123805960 CACGGTCATCATGAACAGCAGGG - Exonic
1091212137 11:133871235-133871257 CAGGTTCCTCAGGCAGAGCAGGG - Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092728134 12:11504450-11504472 GAAGGGCAGCAGGAAGAGGAAGG + Intergenic
1092772798 12:11913301-11913323 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1092835886 12:12487883-12487905 GAGGGTCATGGGGAAGAGAAAGG - Intronic
1093477103 12:19568212-19568234 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1094503238 12:31038524-31038546 AAGGGTCATCAGGAAGCTGTGGG + Intergenic
1094684598 12:32698569-32698591 CAGGGTCTGCAGGAAGCAGATGG - Intronic
1095260499 12:40093755-40093777 CGGGGTCAGCTGGAAAAGGAGGG + Intronic
1095629177 12:44354286-44354308 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1095796116 12:46220464-46220486 TAGGATCATCCGGAAGAGTAGGG + Intronic
1096004543 12:48158324-48158346 CATGTACATCAGTAAGAGGATGG + Intronic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098372504 12:69775406-69775428 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1099549266 12:84022797-84022819 CAGGGCCATCAGGCAGGAGAAGG + Intergenic
1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG + Intronic
1100167632 12:91935523-91935545 CAAGGTTAACAGGAAGAGGTAGG + Intergenic
1100430791 12:94530286-94530308 TGGGGTCAGCTGGAAGAGGAAGG - Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101028689 12:100638816-100638838 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1101254779 12:102966201-102966223 CAGGGTCAGCAGTCAGAGGGCGG + Intergenic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1101831959 12:108264807-108264829 GGGGGTCATAAGGCAGAGGAAGG - Intergenic
1102214061 12:111147709-111147731 CAAGGTCACCTGGCAGAGGAGGG + Intronic
1102570434 12:113824059-113824081 CAGGGTCATGAAGAAAAGCACGG + Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104325186 12:127789144-127789166 GAGTTTCATCAGGTAGAGGAGGG + Intergenic
1104379736 12:128296713-128296735 GAGTGTCATGAGGAAGAAGATGG + Intronic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104629848 12:130391174-130391196 CATGGGCCTGAGGAAGAGGAAGG + Intergenic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1106962472 13:35014912-35014934 CAGGCTCATCTGCAAGAAGATGG + Intronic
1107172832 13:37363330-37363352 CAAGGTCATAAGGAAGATGGTGG - Intergenic
1110656648 13:78007886-78007908 AAGGGTGATCAGAAATAGGATGG - Intergenic
1113152679 13:107282369-107282391 TAGGGTCATAACAAAGAGGATGG + Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113885252 13:113655408-113655430 CAAAGACATCAGGAAGAGAAAGG + Intronic
1114253591 14:20982607-20982629 CAGGGTCATGAGGGTGAGCAAGG - Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1116335349 14:43650257-43650279 TAGGATCATCAGGTAGAGAATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118128315 14:62934589-62934611 AAGGGTCATTAGGAAGAGCTAGG - Intronic
1118292791 14:64541215-64541237 CATGGTCCTCACGAAGATGAAGG + Exonic
1118533905 14:66737210-66737232 AAGGGAGAACAGGAAGAGGAAGG - Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119421877 14:74512068-74512090 GAGTGGCAACAGGAAGAGGAGGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119800668 14:77442210-77442232 CAGGGTTATTATGAAGATGAAGG - Intronic
1121043741 14:90773078-90773100 CAGGGCCTTCAGGGACAGGAGGG + Intronic
1121329407 14:93040612-93040634 CCAGGTCCTGAGGAAGAGGAGGG - Intronic
1122112481 14:99511974-99511996 CAGGGTCAGCAGGCAGAGACAGG - Exonic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1123438463 15:20272753-20272775 CAGGGACAGCAGGAAGTGAACGG + Intergenic
1123632937 15:22274626-22274648 CAGGGCCCTGAGGAAGAGGCAGG - Intergenic
1124510025 15:30316011-30316033 CAGGGGCTTCATGAAGAGGGTGG - Intergenic
1124732865 15:32214542-32214564 CAGGGGCTTCATGAAGAGGGTGG + Intergenic
1124852758 15:33357000-33357022 AAGGGTCTTTAGGAAGTGGAAGG + Intronic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1125197327 15:37062221-37062243 CAAGGGCATCAGTAAGAGGGAGG - Intronic
1125672193 15:41481686-41481708 CAGAATCACCAGGAAGAGGCTGG - Exonic
1126235411 15:46378001-46378023 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1126277128 15:46896492-46896514 TTGGGACATCAGGGAGAGGAAGG + Intergenic
1126616201 15:50583404-50583426 CAGGGTGATTGGGAACAGGAGGG - Intronic
1127296664 15:57614655-57614677 CAGGGCCATTTGGAAGAGGCAGG - Intronic
1127477571 15:59349023-59349045 CATGGACATATGGAAGAGGAAGG + Intronic
1128113999 15:65094252-65094274 GAGGGAGATCAGGAAGAGGTGGG - Intronic
1128630477 15:69260969-69260991 CAGGGTTATCAGGAAGTTGTGGG - Intronic
1128912767 15:71531142-71531164 GAGGGTCATAAGGAAGGGGCTGG + Intronic
1129362151 15:75030604-75030626 CAGGGCCATCAGGGAGTGAAGGG - Intronic
1129644797 15:77420052-77420074 CGTGGTCACCAGGAAGGGGACGG - Exonic
1130385321 15:83406471-83406493 CGTGGCCAACAGGAAGAGGAAGG - Intergenic
1130811295 15:87381356-87381378 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1131283942 15:91042357-91042379 CAGGACCTTCAGGAAGGGGAGGG - Intergenic
1131422945 15:92322383-92322405 CAGGCTCATCTGAATGAGGAAGG - Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1132643771 16:989588-989610 CAGGGGCATCAGGCAGGTGATGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133287192 16:4696051-4696073 CAGGGCCACCAGGATCAGGAAGG - Intergenic
1134031508 16:10995995-10996017 CAGAGGCATCAGGTAAAGGAAGG - Intronic
1134176564 16:12011677-12011699 CAGGTTCATGACGAAGATGACGG - Intronic
1134270673 16:12730402-12730424 CTGGGTCATCGGGAAGATGTGGG - Intronic
1134464918 16:14467033-14467055 CAGGGGCATCAGGAAAAGCGGGG - Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135528820 16:23234949-23234971 GAGGGTTATCAGGGAAAGGAAGG - Intergenic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136537309 16:30907598-30907620 CAGGGTCAGCAGGCAGAGGCGGG + Intergenic
1136550590 16:30980459-30980481 CAGGGTGTTAAGGAAGAGAACGG - Intronic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1137929130 16:52570032-52570054 CAGAGTCAAGAGGAAGAGTATGG - Intergenic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1139342006 16:66273540-66273562 CAGGGTCAGAAGGCAGAAGAGGG - Intergenic
1139436998 16:66942076-66942098 CAGGTGGATCAGGAAGAGGCAGG - Intronic
1139494804 16:67308619-67308641 CAGGCTCTTCAGGAAGAGAATGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1142383243 16:89745998-89746020 CTCGGTCATCAGGGACAGGAGGG - Intronic
1142551789 17:745286-745308 GAAAGTCCTCAGGAAGAGGACGG + Exonic
1143387874 17:6542832-6542854 GAGGGTCTTCAGGAGGAGGTGGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143515439 17:7417345-7417367 CAGGATGTTGAGGAAGAGGAGGG - Exonic
1144260774 17:13517982-13518004 CAGAGTCAACTGGGAGAGGAAGG + Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1145686832 17:26677543-26677565 CAGGGTAATTAGGAAGGAGAAGG + Intergenic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1146092846 17:29899276-29899298 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1146752180 17:35391666-35391688 CAGTGTCATCAGGACTAGGTAGG + Intergenic
1147760258 17:42793564-42793586 GAGGGTCAACAGGATGGGGAGGG - Intronic
1147970757 17:44218452-44218474 GGGGGTCACGAGGAAGAGGAGGG - Intronic
1148643786 17:49207286-49207308 GGGGCTCATCAGGAACAGGAAGG + Intronic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1149721392 17:58848267-58848289 CAGGGTAATCAGGCAGGAGAAGG - Intronic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1153521973 18:5962241-5962263 GAAGGTCATCAGGAAGAAGGGGG + Intronic
1153542209 18:6167825-6167847 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1153709437 18:7783202-7783224 AAGGGTGATCAGCAAGGGGATGG + Intronic
1156361185 18:36386251-36386273 CAGGGAGATGAGGCAGAGGACGG - Intronic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158786026 18:60712670-60712692 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1158816445 18:61103323-61103345 CTGGGTCATTAGGAAATGGAAGG + Intergenic
1158880873 18:61778656-61778678 CAGGGAGATAAGGACGAGGAGGG + Intergenic
1159327267 18:66938442-66938464 GTGGGTCAACAGGAAGCGGATGG - Intergenic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160803472 19:980792-980814 CAGGGGCAGCAGGAAGTCGATGG - Intergenic
1160906931 19:1455958-1455980 CGGGGTTATCAGGAAGAGGCGGG + Intronic
1161120015 19:2520577-2520599 AGCGGGCATCAGGAAGAGGAGGG - Intronic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161877972 19:6926613-6926635 CAGGGTCTTCAGGAAGAGAGAGG - Intronic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1163165105 19:15491400-15491422 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1163669962 19:18621644-18621666 CAGGGACATCAGGCACAGGAAGG - Intergenic
1165992764 19:39825777-39825799 CAGGGTCATCAGGAGGCGGGAGG + Exonic
1166189983 19:41170058-41170080 CAAGTTCATCAAGAAAAGGATGG + Intergenic
1167640070 19:50676467-50676489 CAGGCTCAGGAGGAATAGGAAGG + Intronic
1168131193 19:54320411-54320433 CATGCTCACCAGGATGAGGATGG + Intergenic
1168179173 19:54648624-54648646 CATGCTCACCAGGACGAGGATGG - Intronic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
925443269 2:3906553-3906575 CAGGGTCATCACTCAGAGAATGG - Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925991781 2:9260284-9260306 CTGGGTCATGAGGATGAGGTGGG + Intronic
926791066 2:16572264-16572286 CAGGGTCATAATGAAGATGATGG + Intronic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
928399545 2:30967952-30967974 AAGAGTCCTCAGGTAGAGGAAGG - Intronic
928795737 2:35016577-35016599 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928913239 2:36444072-36444094 CAGGGTCTTCCTGAAAAGGAAGG + Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
932327411 2:70872269-70872291 CCTGGTCCTCAGGAAAAGGAGGG + Intergenic
932634367 2:73375212-73375234 GAGGGTCATCCCAAAGAGGATGG - Intergenic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933260470 2:80126336-80126358 GAGGATCATTAGGGAGAGGAGGG - Intronic
933455779 2:82517440-82517462 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
933810943 2:86032351-86032373 GAGGGTGATGAGGAAGAGGAGGG - Exonic
934040265 2:88122463-88122485 CAGGGGCAGAAGGTAGAGGAAGG - Intergenic
934158362 2:89224742-89224764 CATGGTCATCTGAATGAGGAAGG + Intergenic
934208906 2:89957683-89957705 CATGGTCATCTGAATGAGGAAGG - Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934671746 2:96218200-96218222 CAGGGTCATCAGAAAGTAAAGGG - Intergenic
935020497 2:99225904-99225926 CAGGGCCATCAGGCAGGAGAAGG - Intronic
935708542 2:105877331-105877353 CAGGGTCATCTAGAACAGAAGGG - Intronic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937203610 2:120222377-120222399 CAGGGACCGCAGGAACAGGAGGG + Exonic
937701986 2:124873265-124873287 CAAGGACATCAACAAGAGGATGG + Intronic
937921299 2:127133467-127133489 CAGTCCCATCAGAAAGAGGAGGG + Intergenic
938137397 2:128770464-128770486 CAGGGCCAGCAGGAAGAGCGTGG + Intergenic
938393878 2:130927299-130927321 CACTGACACCAGGAAGAGGATGG + Intronic
939544706 2:143538373-143538395 CAGGGTAATCAGGCAGGAGAAGG - Intronic
940095541 2:149969855-149969877 CAGGGCAATCAGGCAGCGGAAGG + Intergenic
940133276 2:150408035-150408057 CAGGGTCTTCATAAAGATGAAGG + Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940707393 2:157122678-157122700 CAAGGAGATCAGGACGAGGAAGG - Intergenic
940800061 2:158123444-158123466 CAGGGAAATCAGGAAGCGGGGGG - Intronic
940814419 2:158282275-158282297 CAGGGCAATCAGGCAGAAGAAGG + Intronic
941440787 2:165532707-165532729 CAGGGTGATCAGGCAGGAGAAGG + Intronic
941726782 2:168869354-168869376 CAGGGCAATCAGGCAGAAGAAGG + Intronic
942271848 2:174283457-174283479 CAGGACCATCAGGAAAATGAAGG - Intergenic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943265753 2:185729747-185729769 CAGGGTCATCGTGCAGAGTATGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945303415 2:208235485-208235507 CAGTGGCACCAGGAAGAGAACGG - Intergenic
945533538 2:210985205-210985227 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
946047802 2:216835742-216835764 CAGGGTGTTGAGGCAGAGGATGG - Intergenic
946050178 2:216855798-216855820 AAGGGTCATCCGGAGGAGGCTGG + Intergenic
946084644 2:217158254-217158276 GGGGGTCTTCAGGAAGAGGGTGG - Intergenic
946423979 2:219582349-219582371 CAGGGCAATCTGGAAGCGGAAGG + Intergenic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
947740069 2:232480929-232480951 CACGGTCCACTGGAAGAGGAAGG - Intronic
947751257 2:232533926-232533948 CAGGGTCTCCAGGAAGAGCTGGG - Exonic
947943035 2:234075586-234075608 CAGGGGCAGCAGGAAGAAGCCGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
948321231 2:237071507-237071529 AAGGGTTATCAGGAAGAACATGG + Intergenic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1170680242 20:18519856-18519878 CATGGTCAGCAGGGAGAGCACGG + Intronic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1172694358 20:36811930-36811952 CAGGCTCATTATGAAGAGCAAGG + Intronic
1173154216 20:40594230-40594252 CACAGTCAGGAGGAAGAGGAAGG + Intergenic
1173163746 20:40671640-40671662 CAGGGACACCAGGAAGGGCATGG + Intergenic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174710587 20:52700747-52700769 GAGGGTCATCAGGAAACAGAAGG + Intergenic
1174747694 20:53080307-53080329 CTTGGTCTTAAGGAAGAGGATGG + Intronic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1175067381 20:56300994-56301016 CGGGGACCTCAGGAACAGGAGGG - Intergenic
1175341579 20:58234111-58234133 CGTGGTCATCAGGGAGAGAAAGG + Intergenic
1175555778 20:59855226-59855248 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1175954718 20:62603458-62603480 CAGGGTTGGCAAGAAGAGGAAGG - Intergenic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176700772 21:10047208-10047230 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1176980783 21:15378508-15378530 AGGGGTCATCAGGATGTGGATGG + Intergenic
1177279457 21:18961940-18961962 CAGGATCACCAGGTAGAGGCTGG - Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178033049 21:28549886-28549908 CAAGGTCATAAAGAAGAGCAGGG - Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1178594959 21:33945012-33945034 CAGGATCAACAGGCAGAGCACGG + Intergenic
1180082685 21:45493932-45493954 CAGGGCCCCCAGGAAGAGGCTGG - Intronic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180933250 22:19607569-19607591 CACTGTCATCAGGCAGAGGACGG - Intergenic
1181462736 22:23095006-23095028 CAGGTGCATGAGGGAGAGGAGGG - Intronic
1181552993 22:23651675-23651697 CAGGGAGTTGAGGAAGAGGAGGG + Intergenic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1183198021 22:36366781-36366803 AAGGATCATCAGGGAGGGGAAGG + Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183751438 22:39723260-39723282 CAAGGTCATCAGAAAGGAGAAGG - Intergenic
1183774285 22:39953148-39953170 CAGAGTCATCAGAAAGTGGGTGG - Intronic
1183980260 22:41535521-41535543 AAGGACCATCAAGAAGAGGAAGG + Intronic
1184215757 22:43066273-43066295 CTGGGTCATCAGGAAGGAAATGG + Intronic
1184342149 22:43891896-43891918 CGGGGTGATCGGGACGAGGAAGG + Exonic
1185063686 22:48620288-48620310 CAGGGCCCTGAGGAAGAGGCGGG - Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
949446119 3:4135622-4135644 CAGGGCCATCAGGCAGAAGAAGG + Intronic
949493420 3:4610282-4610304 GAGTGTCATCAGGGAGAGGGAGG - Intronic
950063255 3:10090154-10090176 TAGGGTCCTTAGTAAGAGGATGG - Intronic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
950827751 3:15843256-15843278 CAGGGACATCATCAAGGGGATGG + Intronic
950963827 3:17132196-17132218 CAGTGTCAGCAGGAAGCGGAGGG - Intergenic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
951816296 3:26758828-26758850 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
951963485 3:28355000-28355022 CAGGGTAATCAGGCAGGAGAAGG + Intronic
951964360 3:28366137-28366159 CAGGGTAATCAGGCAGGAGAAGG - Intronic
952546856 3:34429734-34429756 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
953266040 3:41389365-41389387 CAGGGTAATCAGGCAGGAGAAGG - Intronic
953319053 3:41955656-41955678 CAGGTTCATCAAGAAGAGAGTGG + Intronic
953395194 3:42563599-42563621 CAGGGTCTCCAGGAAGCAGAAGG + Exonic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954581614 3:51706314-51706336 CAGGGGCATCTGGGAGGGGAGGG - Intergenic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
956866105 3:73370448-73370470 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
957449203 3:80355075-80355097 CCAGGTCATGTGGAAGAGGAGGG - Intergenic
957943172 3:87030897-87030919 GAAGGTCTTCAGGATGAGGATGG + Intergenic
958545920 3:95550268-95550290 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961086375 3:124071082-124071104 GAAGGTGATCAGGAAGGGGAGGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961317877 3:126052768-126052790 CATGGTCAGGAGGAAGAAGAGGG - Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961829908 3:129618122-129618144 GAGGGTGGTCAGGCAGAGGAGGG + Intergenic
965800922 3:172493243-172493265 CAGGGCCATCAGGCAGGAGAAGG - Intergenic
966430502 3:179827272-179827294 GAGTGTCCTCAGGAAGAGGTAGG - Intronic
967791829 3:193558105-193558127 CAGGCTGATCAGGAACAGTAGGG - Intronic
967908209 3:194519364-194519386 CTGGGTTATCAGGCAGAGGCTGG + Intergenic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
969230794 4:5828907-5828929 CTGGGGCATCACAAAGAGGAAGG + Intronic
969458969 4:7317571-7317593 CAGGCCCATGGGGAAGAGGAAGG - Intronic
973055732 4:45655318-45655340 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
974330036 4:60466425-60466447 CAGGGTAATCAGGCAGAAGAAGG + Intergenic
974331868 4:60489858-60489880 AAGGTTCATCAGGAGGAGAAAGG + Intergenic
975150536 4:71015930-71015952 CAGGGTAATCAGGTAGTAGAAGG + Intronic
975166054 4:71179352-71179374 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
976042051 4:80898427-80898449 CAGGTTCAGCTGGCAGAGGAAGG - Intronic
976236849 4:82906524-82906546 CAGGATGATCAAGAAGAGAAAGG + Exonic
976402727 4:84625431-84625453 CAGGAGCATGAAGAAGAGGAAGG + Intronic
976916354 4:90379928-90379950 CAGGGGCAAGAGGAAGAGAAGGG + Intronic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977790082 4:101089262-101089284 AAGAGGCATCAGGAAGAGAAGGG + Intronic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978097973 4:104802909-104802931 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
978231365 4:106404445-106404467 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
978565856 4:110080739-110080761 CAGGGTAATCAGGCAGGAGAAGG + Intronic
978909916 4:114050768-114050790 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
980333019 4:131434305-131434327 GAGGGTCAGCGGGGAGAGGAGGG - Intergenic
980464253 4:133152317-133152339 CATGGCCAGCAGGAAGATGAAGG - Exonic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984593315 4:181640107-181640129 CAGGGACATCAAGAAGATGAAGG + Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
985620099 5:949910-949932 CAGGGTCCTCAGGCAGAAAAGGG - Intergenic
986220626 5:5765758-5765780 CTGCATTATCAGGAAGAGGAGGG - Intergenic
986481405 5:8192067-8192089 CAGCGTCAACAGGAAGAGAGGGG - Intergenic
987234786 5:15931804-15931826 GAGGGGCAGCAGGCAGAGGAGGG - Intronic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
988274108 5:29058085-29058107 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
989843275 5:46108218-46108240 CAGGGTAATCAGGCAGAAGAAGG - Intergenic
989948646 5:50270857-50270879 CAGGGAAATCAGGCAGAAGAAGG + Intergenic
990084349 5:51955931-51955953 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
990604675 5:57396577-57396599 CAGGGTCAAAAGGCATAGGATGG - Intergenic
990678998 5:58220037-58220059 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
991115713 5:62952299-62952321 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
991383559 5:66059531-66059553 CAGGGTAATCAGGCAGGAGAAGG - Intronic
991928668 5:71730231-71730253 AAGAGCCATGAGGAAGAGGAAGG - Intergenic
991942073 5:71862934-71862956 CATGGCCATATGGAAGAGGAGGG - Intergenic
992199741 5:74371388-74371410 CAGGGTCATCGTGAAAAGCATGG + Intergenic
992238280 5:74735404-74735426 CAGGGTCCTCAGGAAGACAAGGG + Intronic
992956117 5:81910116-81910138 GAGGGGCAAGAGGAAGAGGAGGG - Intergenic
993002270 5:82393058-82393080 CGTGGTCATCAGCAAGAGTATGG - Intergenic
994413800 5:99442566-99442588 AAGGGTCATCAGGAAGATGATGG - Intergenic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
995276198 5:110280647-110280669 CAGGGAAATCAGGCAGAAGAAGG - Intergenic
995383923 5:111567583-111567605 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
996574046 5:124962940-124962962 CAGGTTCCACAGGAAGAGGCAGG - Intergenic
996704821 5:126486546-126486568 CAGGCTCTTCTGGCAGAGGACGG + Intronic
997186770 5:131889705-131889727 CAGGGCCATCAGGCAGAAGAAGG - Intronic
997429065 5:133824981-133825003 CAGGGACACCAGGAAAAGGTGGG - Intergenic
997586908 5:135048725-135048747 ATGGGCCCTCAGGAAGAGGAGGG + Intronic
998359703 5:141574073-141574095 CAGAGTCACCAGGTAAAGGAGGG + Exonic
998613249 5:143712149-143712171 CAGGGTAATAAGGAAGCAGAGGG - Intergenic
999038221 5:148377398-148377420 CAGAGTCATCAGGTATATGAGGG + Intergenic
999553618 5:152717586-152717608 CAGGTTCCACAGGAAGAGGAGGG - Intergenic
999861379 5:155650604-155650626 AAGGGTCTTAAGGAAGAGAAAGG + Intergenic
1000789828 5:165592180-165592202 CAGGGCCATCTGCAAAAGGAAGG + Intergenic
1001241011 5:170069829-170069851 CAGAGTCCACAGGAAGAAGAGGG - Intronic
1001482762 5:172099943-172099965 CAGCGTCCTTAGGAGGAGGAAGG + Intronic
1001955027 5:175843094-175843116 CAGGGTCAGCGGGTAGGGGAGGG + Intronic
1002043153 5:176528726-176528748 CAGTGCCAGCAGGAAAAGGAGGG + Exonic
1002572498 5:180150713-180150735 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1003120390 6:3314496-3314518 CAGGGTCTTCAGGAAGATTTAGG + Intronic
1003414606 6:5896774-5896796 CAGGGTCGGGAGGAAGAGGCTGG + Intergenic
1003447827 6:6200792-6200814 CAGGGTCTGCAGGGAGAGAAGGG + Intronic
1004505708 6:16245180-16245202 CAGAGTCATCAGGAAGGAGGTGG + Intronic
1005237167 6:23778035-23778057 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1005240475 6:23819609-23819631 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1005558520 6:27012557-27012579 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1006118995 6:31792638-31792660 CAGGGTCCTGCGGGAGAGGAGGG - Intronic
1006153456 6:32001528-32001550 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006159764 6:32034265-32034287 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006403224 6:33829780-33829802 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403237 6:33829835-33829857 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403250 6:33829890-33829912 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403263 6:33829945-33829967 CAGGGATGTGAGGAAGAGGAGGG - Intergenic
1006403275 6:33830000-33830022 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1007290548 6:40782909-40782931 GAGGATCAGCAGGGAGAGGAGGG - Intergenic
1007377854 6:41468691-41468713 CAGAGTCCCCAGGAAGTGGAGGG - Intergenic
1007617396 6:43188254-43188276 CAAGGTCAAAAGGAAGAAGATGG - Intronic
1007622996 6:43226187-43226209 GAGGTTCATAAGGAAGACGACGG + Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1009980112 6:70717685-70717707 CAGTGACATCAGCAAGATGATGG - Intronic
1010172583 6:72990651-72990673 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1011024711 6:82855073-82855095 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1011272872 6:85597363-85597385 CAGGTATATCGGGAAGAGGATGG + Intronic
1011721230 6:90158536-90158558 AAGGGACATCAGGAAGAGCGTGG + Intronic
1013019608 6:106200051-106200073 GAGGTTCATTAGGAAGGGGAAGG - Intronic
1013052099 6:106546192-106546214 CAGGGACATCAGAAAGAGTGGGG + Intronic
1013507311 6:110814206-110814228 CACAGTCATCTGGCAGAGGATGG + Intronic
1014036855 6:116776744-116776766 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1014202648 6:118622801-118622823 CGGGGTCATCAAAAAGATGAAGG + Intronic
1014391657 6:120872380-120872402 CAGGGTCAGCAGGTTGATGATGG + Intergenic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015374857 6:132498977-132498999 CAAGGTCATCAGATAGAGAATGG - Intronic
1015639302 6:135313754-135313776 CAGGCACATCAGGAAGAGGAAGG + Intronic
1016314297 6:142769946-142769968 GATGGTCAGCTGGAAGAGGAAGG - Exonic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016529552 6:145042621-145042643 CAGGGACTTAAGGAAGAAGAGGG - Intergenic
1016584290 6:145666160-145666182 CAGGGCAATCAGGCAGAAGAAGG + Intronic
1017718772 6:157230485-157230507 CAGGGCCATCAGGAGAAGCAGGG + Intergenic
1018062914 6:160104475-160104497 CAGTCTCATTAGGAACAGGAAGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1019372656 7:671007-671029 CAGGCTCATCAGCCAGAAGATGG + Intronic
1019560010 7:1651215-1651237 CTGGGTCCTCAGGCCGAGGATGG + Intergenic
1022633186 7:32105379-32105401 CATGGTCCTCTGGAAGAGAAAGG + Intronic
1023039447 7:36159671-36159693 CAGGGTCTTGGGGAAAAGGAGGG + Intronic
1024706694 7:51969373-51969395 CAGGGATCTGAGGAAGAGGAAGG + Intergenic
1025942443 7:66083997-66084019 CAGGGAGTTGAGGAAGAGGAGGG - Intronic
1026231899 7:68491116-68491138 GATGGTCATCAGGATGGGGAGGG + Intergenic
1026309466 7:69171237-69171259 CACTGTCATAATGAAGAGGATGG - Intergenic
1026821146 7:73549928-73549950 GAGGGACAGGAGGAAGAGGATGG + Intronic
1027209968 7:76138228-76138250 AAGGGTCATCAGGATGATCATGG - Intergenic
1027601402 7:80245520-80245542 TACGGTCTTCAGGAGGAGGAAGG - Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028257459 7:88617302-88617324 CAGAGTCATCTGGAAGATGGAGG + Intergenic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1029154909 7:98509913-98509935 CATGCCCATTAGGAAGAGGAAGG - Intergenic
1029192500 7:98781685-98781707 CTGGTTCAGCAGGAAGAGGCTGG + Intergenic
1029201633 7:98843226-98843248 CAGGGTCATCAGGCAGGGAATGG - Intergenic
1029245059 7:99193371-99193393 CATGGTTCTCAGGAAGACGAAGG + Intronic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029709692 7:102292952-102292974 CAGGAGCACCGGGAAGAGGAGGG - Intronic
1030131826 7:106208013-106208035 CAGGATCGTGAGGGAGAGGAAGG - Intergenic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1031074354 7:117198706-117198728 CAGGTGCAACAGGGAGAGGAAGG - Intronic
1031145190 7:117989670-117989692 CAGGAACATCAGGAAGAATATGG - Intergenic
1033437034 7:141342526-141342548 GAGGGTCATCAGGAAGACCTCGG - Intronic
1033551477 7:142451819-142451841 CAGGGTCACCAGGGAGAGACGGG - Intergenic
1033555946 7:142488668-142488690 CATGGTCACCAGGAAGAGACAGG - Intergenic
1034203842 7:149298994-149299016 CTGGATCATCAGGGACAGGATGG - Intergenic
1034371445 7:150601221-150601243 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1034718953 7:153270277-153270299 CAGGGTGATCAGGCAGGAGAAGG + Intergenic
1034752505 7:153584025-153584047 CAAGGTCAGCAGGGAGAGAAGGG + Intergenic
1035238086 7:157513189-157513211 CTGTGTCATCAGGCTGAGGAGGG + Intergenic
1035455448 7:159006026-159006048 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455457 7:159006064-159006086 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455466 7:159006102-159006124 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455474 7:159006140-159006162 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455485 7:159006178-159006200 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455494 7:159006216-159006238 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455503 7:159006254-159006276 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455519 7:159006330-159006352 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455527 7:159006368-159006390 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455537 7:159006406-159006428 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455546 7:159006444-159006466 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455554 7:159006482-159006504 CTGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455563 7:159006520-159006542 CGGTTTCCTCAGGAAGAGGACGG + Intergenic
1035455572 7:159006558-159006580 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455590 7:159006634-159006656 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455599 7:159006672-159006694 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1035455608 7:159006710-159006732 CGGCTTCCTCAGGAAGAGGACGG + Intergenic
1037255483 8:16947980-16948002 CAGGGCAATTAGGCAGAGGAAGG + Intergenic
1037512499 8:19598046-19598068 GAGGGTCAAGAGGAAGGGGAAGG + Intronic
1038301108 8:26349724-26349746 CAGGCTCATAAAGGAGAGGAAGG - Intronic
1038520782 8:28230379-28230401 CCTGGTCATCAGGAGGAGGTAGG + Intergenic
1038846336 8:31233257-31233279 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1038929334 8:32175479-32175501 CAGGGCTATCAGGCAGAAGAAGG + Intronic
1039112831 8:34058913-34058935 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1040541035 8:48355875-48355897 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1041180599 8:55243813-55243835 AAGGGACAACTGGAAGAGGAAGG + Intronic
1042312198 8:67390155-67390177 CTGGGTCATCAGGAATGGGTAGG + Intergenic
1042364626 8:67922582-67922604 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1042392898 8:68256387-68256409 CAGAGTCCTGAGGAAGAGGTGGG + Intergenic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1042720746 8:71824392-71824414 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1042801931 8:72728367-72728389 CAGGATTAACAGGAATAGGATGG - Intronic
1043697017 8:83232491-83232513 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044820478 8:96152846-96152868 CAGGCCCCTCAGGAAGAGAAGGG - Intronic
1044953093 8:97452484-97452506 AATGGTCAGCAGGATGAGGATGG + Intergenic
1046877047 8:119266668-119266690 CAAGGACAGCAGGGAGAGGAAGG + Intergenic
1047035007 8:120927968-120927990 AAGGATCAGCAGGAAGAGCATGG + Intergenic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047300450 8:123609417-123609439 CAGGGTCCTCAGGGAGGGAAGGG + Intergenic
1048286266 8:133144199-133144221 CTGGGTCATTAAAAAGAGGAAGG + Intergenic
1049065199 8:140308085-140308107 AAGTGTCATCAGGCAGAGCAGGG + Intronic
1049425401 8:142535822-142535844 CAGGTCCATGAGGGAGAGGATGG + Intronic
1050007512 9:1148345-1148367 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1050960223 9:11720670-11720692 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1051790595 9:20797840-20797862 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1051890147 9:21932885-21932907 CAGAGTAATTAGGCAGAGGAGGG - Intronic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053534399 9:38911842-38911864 GAGGGTCCTAAGGAAGAGGTAGG - Intergenic
1053637913 9:40033710-40033732 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1053718368 9:40919923-40919945 CAGGGTAATCAGGCAGGAGAGGG + Intergenic
1053768169 9:41431510-41431532 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1054546837 9:66343014-66343036 CAGGGTAATTAGGCAGGGGAAGG - Intergenic
1054631734 9:67452085-67452107 GAGGGTCCTAAGGAAGAGGTAGG + Intergenic
1055099795 9:72451735-72451757 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056137424 9:83643943-83643965 CTGGTTCATCAGGAAGCAGAGGG + Intronic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056631664 9:88298664-88298686 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1058626478 9:106938902-106938924 CATGCTCACCTGGAAGAGGATGG - Exonic
1058714597 9:107712502-107712524 CAGACTCATGTGGAAGAGGAAGG - Intergenic
1058836943 9:108865595-108865617 GAGGGTCTTAATGAAGAGGAGGG + Intergenic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1059277652 9:113109350-113109372 GAGGGGGATCAGGAACAGGAAGG + Intergenic
1059278599 9:113115201-113115223 GAGGGGGATCAGGAACAGGAAGG - Intergenic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1060484704 9:124039746-124039768 GAAAGTCATCAGGAAGAGGAAGG + Intergenic
1061134903 9:128728298-128728320 CAGGGTTCTGAGGAAGCGGAAGG + Intergenic
1061338113 9:129956692-129956714 CAGGGCCATCTGGAAGAGCTTGG - Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1062068500 9:134541633-134541655 CTGTGTCATGAGGATGAGGAGGG + Intergenic
1062417996 9:136463137-136463159 TTGGGTCAACAGGAACAGGAAGG + Intronic
1202785783 9_KI270719v1_random:17266-17288 CAGGGTAATTAGGCAGGGGAAGG + Intergenic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1187111407 X:16304792-16304814 CAGGATCCTGAGGAAAAGGAGGG + Intergenic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1187453594 X:19421180-19421202 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1187583317 X:20632537-20632559 CTGATTCATCAGGAAGAGGTTGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188012888 X:25076067-25076089 AAGGATAATCAGGAAGAGAATGG - Intergenic
1188652941 X:32654144-32654166 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1190967914 X:55319826-55319848 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1191233070 X:58112239-58112261 CAGGGAAATCAGGCAGGGGAAGG + Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1192073465 X:67965271-67965293 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1192194591 X:69019677-69019699 CAGGGACATCAGGGAGGGGAGGG + Intergenic
1192895915 X:75442300-75442322 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193011135 X:76675990-76676012 CAGGGCCATCAGGCAGCAGAAGG + Intergenic
1193059361 X:77188599-77188621 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1193370090 X:80685517-80685539 TAGGGTCATCAGGAGCAAGAGGG - Exonic
1193735453 X:85150963-85150985 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1194630189 X:96273512-96273534 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1194961371 X:100240086-100240108 CAGGTTGATCTGGAAGAGAAAGG - Intergenic
1195395408 X:104405219-104405241 CAGGGCAATCAGGCAGAAGAAGG - Intergenic
1195408925 X:104547848-104547870 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1195414974 X:104610279-104610301 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1195624910 X:106997872-106997894 CCAGTTTATCAGGAAGAGGAAGG - Intronic
1196077167 X:111590692-111590714 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1196735757 X:118979627-118979649 CAGGGACATTAGAAAGAGGAAGG + Intronic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1197885163 X:131210692-131210714 CTGGGTCATCCGTGAGAGGAAGG - Intergenic
1197984818 X:132256197-132256219 CAGGGACATCAGAAAAAGGAAGG + Intergenic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1200885804 Y:8268242-8268264 CAGGGCAATCAGGCAGAAGAAGG + Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201258971 Y:12138995-12139017 CAGGGCAATCAGGCAGCGGAAGG + Intergenic
1201506289 Y:14704153-14704175 CAGGGCAATCAGGCAGAAGAAGG - Intronic
1201974690 Y:19836096-19836118 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1202092411 Y:21208120-21208142 CAGTAACATCAGGAAAAGGAAGG + Intergenic