ID: 1119567423

View in Genome Browser
Species Human (GRCh38)
Location 14:75640660-75640682
Sequence CAGCATTTACAGAAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119567423_1119567428 -5 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567428 14:75640678-75640700 TGCTGACTGGCTGTCACTGATGG 0: 1
1: 0
2: 1
3: 18
4: 178
1119567423_1119567429 3 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567429 14:75640686-75640708 GGCTGTCACTGATGGCAAGATGG 0: 1
1: 0
2: 0
3: 12
4: 196
1119567423_1119567432 27 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567432 14:75640710-75640732 GAAGCAGCAAGGGATCCCAGAGG 0: 1
1: 0
2: 5
3: 29
4: 349
1119567423_1119567430 16 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567430 14:75640699-75640721 GGCAAGATGGAGAAGCAGCAAGG 0: 1
1: 0
2: 4
3: 65
4: 477
1119567423_1119567431 17 Left 1119567423 14:75640660-75640682 CCTTGCCCCTTCTGTAAATGCTG 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1119567431 14:75640700-75640722 GCAAGATGGAGAAGCAGCAAGGG 0: 1
1: 0
2: 1
3: 42
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119567423 Original CRISPR CAGCATTTACAGAAGGGGCA AGG (reversed) Intronic
904475646 1:30763084-30763106 CTGCATTTACAGAAGGTCGAAGG - Intergenic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
904756207 1:32770156-32770178 CTGGATTGACAGGAGGGGCAGGG + Exonic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906919635 1:50049216-50049238 AAGCATTTAGGTAAGGGGCATGG - Intronic
908438640 1:64131526-64131548 TATCATTTACACAAGGGCCAAGG - Intronic
911930641 1:103899143-103899165 GTACATTTACAGAAGAGGCAGGG + Intergenic
912309168 1:108602344-108602366 CAGCACTTCCAGAGGGAGCATGG - Intronic
915527176 1:156483109-156483131 AAGCTATTACAGAAGGGGAAGGG - Intronic
915567998 1:156727325-156727347 CAGCCTTTTTTGAAGGGGCAGGG + Exonic
916341814 1:163745133-163745155 CAGCATTTACAGACTGGCCCTGG - Intergenic
918370313 1:183854334-183854356 CAGCTTTTCCTGAAGGGTCAGGG + Intronic
919313690 1:195945351-195945373 AAGCATTTAGAGAAAGGGAAAGG - Intergenic
922653686 1:227362665-227362687 CAGCATTTACTCAAGGGAGATGG + Intergenic
924482518 1:244450370-244450392 CAGCTATTTCAGAATGGGCAGGG + Intronic
1063185576 10:3647816-3647838 CAGGACTTGCAGCAGGGGCAGGG - Intergenic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG + Intronic
1064183714 10:13141847-13141869 CAGCATTTACAAAAGGGAGATGG - Intergenic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1067563855 10:47322694-47322716 CAGCAGGGACAGCAGGGGCAGGG - Exonic
1067731363 10:48814042-48814064 CAGCATTTCCAGGAGGAGCAAGG - Exonic
1068630280 10:59290855-59290877 CAGTATTTGCAGGGGGGGCAGGG + Intronic
1074183956 10:111085498-111085520 CAGCACCTTCAGAAGGGGCGAGG + Intergenic
1074184444 10:111088466-111088488 CAGCACCTTCAGAAGGGGCGAGG - Intergenic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1080658892 11:34280059-34280081 AAGCATTTAGAGACTGGGCACGG - Intronic
1081520881 11:43880336-43880358 CAGCATTTACAGCAGGGCGTAGG - Intergenic
1081635528 11:44718977-44718999 CAGCAGTTACACAAGGTGCTCGG - Intergenic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083202349 11:61128147-61128169 CATAATTTACGGAATGGGCAGGG - Intergenic
1084785951 11:71441767-71441789 CAACAATTACAGAGGGGGCCAGG - Intronic
1088863228 11:113821557-113821579 CAGCATTCTTTGAAGGGGCAGGG + Intronic
1089138666 11:116269531-116269553 CAGAATTTAAAGGAAGGGCAAGG - Intergenic
1090043665 11:123312632-123312654 AAACATTTACAGAATGGGAAAGG - Intergenic
1092604429 12:10102751-10102773 CAGCCTTGACAAAAGGGGCTGGG - Intronic
1093514028 12:19964415-19964437 CAGGAGTTACATAAGGGACAAGG - Intergenic
1102559243 12:113750325-113750347 GACCATTCACAGAAGGGACATGG - Intergenic
1102652677 12:114453487-114453509 CTGCAATTATAGCAGGGGCATGG + Intergenic
1104425765 12:128676990-128677012 CAGCACCTAGAGAAGGGCCAAGG + Intronic
1104468849 12:129012153-129012175 CAGCCTTTAAAAAAGGGGCTGGG - Intergenic
1104741465 12:131177878-131177900 CAGCCTTTACAGAGGAGGCTGGG - Intergenic
1104929674 12:132331663-132331685 CGGCATTTTCAGGAGGGACACGG - Intergenic
1105008999 12:132742351-132742373 CAGCAATTACAGAAGGGGTGTGG + Intronic
1105987981 13:25588442-25588464 CGGCATTTACCTAAGGGACAAGG - Intronic
1108609477 13:52070122-52070144 CAGCATTTACAGAACTGACTTGG - Intronic
1112331591 13:98481092-98481114 CTGCACTTACAGAAGGGGTGGGG + Intronic
1112937337 13:104817385-104817407 CAGCATGCACAGCAGGGGAAGGG + Intergenic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1115980994 14:39051379-39051401 CAGCATTTACAACAGCAGCAGGG - Intronic
1116372647 14:44155115-44155137 CAGTATTTACAGAATGGCCTTGG - Intergenic
1116643891 14:47501769-47501791 CAGAACTTTCAGAAGTGGCATGG + Intronic
1119520355 14:75280098-75280120 GAGCATTGGCAGGAGGGGCAAGG + Exonic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1119690971 14:76672246-76672268 CAGCTCTCACAGAAAGGGCAGGG - Intergenic
1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG + Intergenic
1122135474 14:99630369-99630391 CAGCCTTTACAGAAAGGCCTTGG + Intergenic
1126702389 15:51380064-51380086 CAGAAGTTACTGATGGGGCAAGG + Intronic
1127303207 15:57677911-57677933 AAGCATTTAGAGACTGGGCATGG + Intronic
1128291665 15:66482857-66482879 CAGTCTTTACAGAAGTGGCGGGG + Intronic
1129329186 15:74818159-74818181 TTGGATTTACAGAAGGGGCCAGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132270248 15:100517811-100517833 GAGCGTTTACAGGAGAGGCAGGG + Intronic
1132609368 16:807592-807614 CTGCATTTAGAGAAGGGGGATGG + Exonic
1134045862 16:11100404-11100426 CAGCTTTCACAGCAGGAGCAGGG - Intronic
1134092088 16:11396896-11396918 CAGCACTTACGGAGGGAGCAAGG - Intronic
1135112810 16:19703958-19703980 CAGAATTTACACCAGGGGCAAGG + Exonic
1135898512 16:26432887-26432909 CAGCATTTAAAGGAGAGACATGG + Intergenic
1136851194 16:33613665-33613687 GAGCATTTTCAGAAGGGGAACGG + Intergenic
1137694332 16:50451232-50451254 AAACATTTGCAGGAGGGGCATGG - Intergenic
1137744335 16:50809842-50809864 CGGCATTTACCTATGGGGCAAGG - Intergenic
1138093675 16:54195822-54195844 TTGCATCTCCAGAAGGGGCAGGG + Intergenic
1139176277 16:64692219-64692241 ATGCATTTAAAGAAGGGCCATGG - Intergenic
1139751577 16:69112174-69112196 CAGCATATAAAGAATGGGCTAGG + Intronic
1141330689 16:83108290-83108312 AAACATTTACAGGTGGGGCATGG - Intronic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1203112799 16_KI270728v1_random:1462126-1462148 GGGCATTTTCAGAAGGGGAATGG + Intergenic
1143418423 17:6768675-6768697 CAGCAATAACAGAAGTGGGATGG - Intronic
1148489302 17:48012858-48012880 CAGCACTTACAGAACGGGAATGG - Intergenic
1148739087 17:49881745-49881767 CAGGATTTAGAGAAGGGGCTTGG - Intergenic
1152988656 18:342588-342610 CTGCATGTACAGAAAGGGAAAGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1155214291 18:23629463-23629485 CAGCATTATCAGCAGGGGCCAGG + Intronic
1155416523 18:25605127-25605149 CACCATGAACAGAAGGGGCTGGG + Intergenic
1157621531 18:49020132-49020154 CAGCAGTTACAGCAGGAGCCAGG - Intergenic
1158940557 18:62403166-62403188 CAGCCTCTACTGAAGGGGTACGG - Intergenic
1159576623 18:70186332-70186354 CAGCATTTAGTGAAATGGCATGG - Intronic
1161681566 19:5682258-5682280 CTGCATTGACAGAAGAGGCAGGG + Intronic
1165126886 19:33604425-33604447 AAGCATTTACAGCAAAGGCATGG - Intergenic
925115774 2:1377349-1377371 CAGCAATCACAAAAGGGCCATGG - Intronic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925609029 2:5688492-5688514 TAGCATTTACAGAAATGGAATGG + Intergenic
926225258 2:10962379-10962401 CAGCGTCTACAGCAGGGGCCGGG - Intergenic
928071878 2:28225224-28225246 CAGCAGCTAGAGAAAGGGCAAGG + Intronic
928789102 2:34929796-34929818 CTGCAATTATAGCAGGGGCATGG - Intergenic
929948487 2:46388494-46388516 CTGCATGATCAGAAGGGGCAGGG - Intergenic
930845233 2:55896293-55896315 CAGCCTTTGCAGAAGTTGCAAGG - Intronic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
932499155 2:72166768-72166790 CAGCCTATACTGAAGGGGCAGGG - Intergenic
933207300 2:79521850-79521872 CAGCATGAACTGGAGGGGCAGGG + Intronic
937256808 2:120561425-120561447 CAGCACTGTCAGAATGGGCAAGG - Intergenic
938146726 2:128840609-128840631 CTGAGTTGACAGAAGGGGCATGG + Intergenic
939569516 2:143824197-143824219 CAGCATATGCAGAAGTGTCATGG + Intergenic
941498881 2:166243650-166243672 CAGAATGTACACAAGAGGCAAGG + Intronic
942326147 2:174778670-174778692 TCACATTTACAGAAGGGTCATGG + Intergenic
944214195 2:197237888-197237910 CAGCATTTTCAGGAGTGGAAGGG - Intronic
946215747 2:218182181-218182203 CAGCATTTAAACAAGGGGCCTGG + Intergenic
948017891 2:234704957-234704979 CAGCTTCTGCAGAGGGGGCAGGG + Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1170530727 20:17288294-17288316 CAGCATTTCAAGAAGGGGAGAGG + Intronic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1171152297 20:22837829-22837851 ATGCACTTACAGAAGGTGCATGG + Intergenic
1173307329 20:41862906-41862928 CTGGATTTATAGCAGGGGCAGGG - Intergenic
1174557244 20:51404691-51404713 CTGCATTTTCAGAATGGGCAGGG + Intronic
1177722845 21:24929312-24929334 CAGATTTTATAGAAGGAGCAGGG - Intergenic
1178471858 21:32900859-32900881 CCGCATTAACAGATGGGGAATGG + Intergenic
1178627634 21:34231561-34231583 TAACATTTACAGAAGGTGCTGGG - Intergenic
1179023318 21:37658666-37658688 CAGCGCTTACAGGAGGGGAAGGG + Intronic
1183414243 22:37673497-37673519 CAGCAGTTTCAGAAGGGGGACGG + Intergenic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
950888430 3:16381283-16381305 CAAAATTTACTTAAGGGGCATGG + Intronic
952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG + Intronic
952988956 3:38814253-38814275 CAGCAATTTAAGAGGGGGCAGGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953391841 3:42538437-42538459 CAGCATATCCAGGAGTGGCACGG + Intergenic
953512809 3:43560007-43560029 CAGCAATGACAGAAGGGGCTAGG + Intronic
953578477 3:44132268-44132290 CAGCATTTACAGATGAGCAATGG - Intergenic
954666227 3:52254162-52254184 CAGCAATGACTGACGGGGCAAGG - Intergenic
955075184 3:55607009-55607031 CAGTATTAACAGCAAGGGCAGGG + Intronic
957758163 3:84519026-84519048 CAGAAATTACACAAGGGGAAAGG - Intergenic
958171928 3:89948866-89948888 CAGCTTTGACAGAAGTGGCTGGG - Intergenic
960637458 3:119797294-119797316 CAGCATTCACAGAAAGGAAATGG + Intronic
961048864 3:123729362-123729384 CAGCCTTTACAGAATGGGAGAGG + Intronic
964009871 3:151879473-151879495 CAACAATTTCAGAAGGGGCAAGG - Intronic
964020003 3:151998648-151998670 AAACATTTACCTAAGGGGCAAGG - Intergenic
964644542 3:158944430-158944452 CAGCAATTACAGAAGAGGGTGGG - Intergenic
964764779 3:160169393-160169415 CTGCATTTAGAGAAGAGGCTGGG - Intergenic
967773398 3:193359209-193359231 CAGCATTTACAGAAGGATCAAGG - Intronic
969051514 4:4376635-4376657 CAGCAGTTAAGGAAGAGGCAAGG - Intronic
969352625 4:6606494-6606516 GGGCATGTACAGAGGGGGCATGG - Intronic
971826828 4:31634197-31634219 CATCATTTTCAGAATGGACAAGG - Intergenic
974475221 4:62370479-62370501 CTGCATTTACAGTAGAGACAGGG - Intergenic
976232069 4:82854856-82854878 CTGCATTTACATACGTGGCAGGG - Intronic
984020196 4:174475761-174475783 CAGCCTTTACAGCAGTGGCTGGG - Intergenic
984022605 4:174504139-174504161 GAGCATTTGCAGAAGGGAAATGG - Intronic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
984652601 4:182286539-182286561 CTGCATCTACAGAAAGGGCTGGG - Intronic
984772493 4:183449590-183449612 CAGCATATAGAGAAGTGACAAGG - Intergenic
985214234 4:187633227-187633249 CAGCATTTCCAGCAGAAGCAAGG - Intergenic
989967219 5:50478598-50478620 CAGGTTTTATAGAAGGGGGAAGG + Intergenic
990343833 5:54851746-54851768 CACCAGTTACAGAAGAGGCCCGG + Intergenic
990855871 5:60265757-60265779 CAGCATTTTTTGAAGGAGCAAGG - Intronic
992967677 5:82019943-82019965 CAGCAGTTGTAGAAGGGGGATGG + Intronic
993846032 5:92944656-92944678 CAACATTTACAGAAGGGAAAGGG - Intergenic
994135129 5:96277946-96277968 CAGCCTTCAGAGAAGGGGGATGG - Intergenic
996791107 5:127294019-127294041 CAGCATATACAGCTGGGTCATGG - Intronic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1001034637 5:168288928-168288950 CATAATTTTCAGAAGGGGAAAGG + Intergenic
1001455647 5:171857991-171858013 CTGCATTTAGGAAAGGGGCACGG - Intergenic
1001619389 5:173070187-173070209 CAAAATTTACTGTAGGGGCAAGG - Intronic
1001911005 5:175517777-175517799 CAGCCTTTGCGGAAGAGGCATGG - Intronic
1001934696 5:175695778-175695800 CAGCATTTAAGGATGGGCCAGGG + Intergenic
1002395805 5:178953183-178953205 CAGGAGTCACTGAAGGGGCAGGG - Intronic
1003629035 6:7770060-7770082 CAGCATTTAAAAAGGGGGCGAGG - Intronic
1005742658 6:28806970-28806992 CAGGATTTCCAGAAGAGCCAGGG + Intergenic
1007117190 6:39351059-39351081 CAGCAGTCACCGAAGGGGCTTGG + Intronic
1008060717 6:46993854-46993876 CACCATTTACAGAAAGGGAGAGG - Intergenic
1011199299 6:84817529-84817551 CAGCATTTTCAGAAATGGCGTGG + Intergenic
1011521654 6:88213501-88213523 CAGCATATACACAAAGGACATGG + Intergenic
1011674199 6:89715439-89715461 CAGCATAAACAAGAGGGGCAAGG - Intronic
1012716651 6:102681816-102681838 CAGAATTTAGAGGAGGGGTAAGG + Intergenic
1013275505 6:108581060-108581082 CAACTTCCACAGAAGGGGCAGGG - Intronic
1015937248 6:138416091-138416113 CAGCATGTACTGCAGGGGCCAGG + Exonic
1016032362 6:139351103-139351125 CAGCCTTTCTAGTAGGGGCAGGG - Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1018653477 6:166010375-166010397 CAGCCTTGACAGCAGAGGCAGGG - Intergenic
1019901669 7:4025972-4025994 CAGCATTTCCAGCAGGGGAGGGG - Intronic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1022334405 7:29408668-29408690 AAGAATTTAATGAAGGGGCAAGG + Intronic
1023763640 7:43490281-43490303 CAGCATTTACGGTTGGGGAATGG - Intronic
1023840216 7:44092891-44092913 CAGCTTTAACAGTAGGGGCCAGG + Intergenic
1027465807 7:78513622-78513644 CAGCAGTTACAGAAAGCCCATGG - Intronic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029469407 7:100744722-100744744 CAGCATTTACTGAAGCTGCTGGG - Intronic
1029886367 7:103876994-103877016 GAGCATTTCCAGAAGGGGTGAGG - Intronic
1030742040 7:113121162-113121184 CAGCATTTACAGAAGTGTATGGG + Intergenic
1030957444 7:115872667-115872689 CAGCATTTACTTAGGGGACACGG - Intergenic
1032821239 7:135526284-135526306 CTACTTTTACACAAGGGGCATGG + Intergenic
1034222425 7:149456839-149456861 CAGCCTCTACAGCAGGGGCCGGG - Intronic
1034816656 7:154177808-154177830 CAGCATTGGCAGAAGGCTCATGG + Intronic
1036080309 8:5548043-5548065 CAGCATATACACATGGTGCAAGG - Intergenic
1036391277 8:8326467-8326489 CCACATTTATAGAAGGGCCAGGG + Intronic
1037618382 8:20541988-20542010 CATCATTTAGAGAAGAGGAAGGG - Intergenic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1039654152 8:39380459-39380481 CAGCATTTTCACAACGGGTAGGG + Intergenic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1040892998 8:52336895-52336917 CAGAAACTACAGAAGGGGCATGG - Intronic
1041272339 8:56121706-56121728 CAGCATTTAAAGGAGGACCAGGG - Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1044107860 8:88234570-88234592 CTGCAGTTAAAGAAGGGTCAAGG - Intronic
1044224415 8:89703478-89703500 CAGCCTTGACAGAAGTGGCTGGG + Intergenic
1045695816 8:104807598-104807620 CAGAATTTAAAGCAGAGGCAGGG - Intronic
1046179770 8:110629483-110629505 CAGCTTTAACCTAAGGGGCACGG + Intergenic
1046284662 8:112079486-112079508 CAGCCTTGACAGAAGGGGCTTGG + Intergenic
1046625091 8:116568310-116568332 AAGCATTCAGAGAAGGGCCAGGG + Intergenic
1047806305 8:128364425-128364447 CAGCCTTTTCAGAAGTGGAAGGG - Intergenic
1048285421 8:133137539-133137561 CAGCATGTCCAGGAGGGGCGGGG + Intergenic
1049470064 8:142771272-142771294 AAGCATTAGCAGCAGGGGCATGG + Intronic
1049909401 9:250856-250878 AAGCTTTTACAGAAGGGTGAGGG + Intronic
1051535235 9:18150252-18150274 CAGCCTTTAAAGGATGGGCAGGG + Intergenic
1051624356 9:19084521-19084543 CAGAATTTACAAAAGAGGGAGGG + Intronic
1051674701 9:19547308-19547330 CAGCACCTGCAGAATGGGCAGGG - Intronic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1055274164 9:74595374-74595396 CAGCATACAAAGAAAGGGCATGG - Intronic
1056296621 9:85199489-85199511 TGGCATTTTCAAAAGGGGCAAGG - Intergenic
1056488508 9:87082885-87082907 CAGAATTTCCAGAAGGTGAATGG - Intergenic
1058315057 9:103554593-103554615 GGGCATTCACAGAAGTGGCAGGG - Intergenic
1058876953 9:109252668-109252690 AATCATGTACAGAAGGGGCCAGG + Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060722270 9:125987101-125987123 CAGAATTGCCAGAAGGGGCTGGG - Intergenic
1061399824 9:130362198-130362220 CAGCATCTACGGGAGGTGCAGGG - Intronic
1062026323 9:134342340-134342362 CCTCATTTACAGAGGGGGCCTGG + Intronic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1187707134 X:22020114-22020136 CATCATTTACAAATGGGGGATGG - Intergenic
1188338932 X:28975246-28975268 CAAGAGTTGCAGAAGGGGCAGGG - Intronic
1188733474 X:33682347-33682369 CTGCATTAACAGTAGGTGCATGG + Intergenic
1188790469 X:34403349-34403371 CAGCATTGATAGAAGTGGCTGGG + Intergenic
1189380238 X:40497562-40497584 CTGCATTTCCAGAATGGGAAGGG - Intergenic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1189522638 X:41785806-41785828 CAGCCTATACACAAGGGGGATGG - Intronic
1189715993 X:43866831-43866853 CACCAGATCCAGAAGGGGCATGG + Intronic
1192770907 X:74189321-74189343 CATCATTTAGAAAAGGGGTAGGG + Intergenic
1193656570 X:84205605-84205627 GGGCATTTAGAGAAGGGCCAGGG - Intergenic
1197178904 X:123513102-123513124 CAGTATTTGGAGTAGGGGCAAGG - Intergenic
1200109244 X:153731315-153731337 CAGCAGCTACAGAAGAAGCAGGG - Intronic
1200836107 Y:7733127-7733149 CAAAATTTACCTAAGGGGCATGG + Intergenic